ID: 1073287774

View in Genome Browser
Species Human (GRCh38)
Location 10:102398867-102398889
Sequence GAGGGGGTACTGATGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 587}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073287764_1073287774 6 Left 1073287764 10:102398838-102398860 CCGGGGGCTACGGAGGAGCTGGA 0: 1
1: 0
2: 1
3: 26
4: 286
Right 1073287774 10:102398867-102398889 GAGGGGGTACTGATGGAGGGAGG 0: 1
1: 0
2: 1
3: 37
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073287774 Original CRISPR GAGGGGGTACTGATGGAGGG AGG Intronic
900151266 1:1180249-1180271 GAGGGGCTCCTGCTGGGGGGTGG + Exonic
900176839 1:1294833-1294855 AAGGGGGTCCTGAGGGTGGGAGG + Intronic
900996963 1:6127990-6128012 GCGGGGCTGCGGATGGAGGGCGG + Intronic
900996970 1:6128009-6128031 GCGGGGCTGCGGATGGAGGGCGG + Intronic
901126740 1:6934665-6934687 GAGGGGGTGGTGGTGAAGGGAGG - Intronic
901352711 1:8611905-8611927 GAGGGAGTAGTGAGGGAGGTAGG - Intronic
901652161 1:10749231-10749253 TAGGGGGGAAAGATGGAGGGAGG - Intronic
902799098 1:18818419-18818441 GAGGGGGAGCTGAGGGAGGTGGG + Intergenic
903043836 1:20551943-20551965 GGGAGGGTACTCTTGGAGGGTGG - Intergenic
903406772 1:23103900-23103922 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
904846557 1:33423038-33423060 GAGAGAGTACAGATGGAAGGCGG + Intronic
904969663 1:34409228-34409250 GCTGGAGGACTGATGGAGGGGGG + Intergenic
905340756 1:37275721-37275743 GAAGGGGTGCTGAGGGATGGAGG - Intergenic
905546968 1:38807640-38807662 GGGAGGGTGCTCATGGAGGGCGG + Intergenic
905786481 1:40761928-40761950 GTGGTGGTAGTGATGGGGGGTGG - Intronic
905840035 1:41168859-41168881 GTGGGGGTATTGATGGAATGTGG - Intronic
907017241 1:51028903-51028925 GAGGGGGCAGGGAGGGAGGGAGG - Intergenic
908361375 1:63371444-63371466 GAGGGGGAATTGATGGAGTGTGG + Intronic
908733280 1:67248958-67248980 GAGGGGGGGCTGAAGCAGGGTGG - Intronic
909928988 1:81473123-81473145 GAGGAGGTGATGATGGAGAGTGG + Intronic
910004066 1:82373543-82373565 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
910341235 1:86190444-86190466 GAGATGATACTCATGGAGGGCGG - Intergenic
911115257 1:94239441-94239463 GAGGGTGTATGGATGGAGGTGGG + Intronic
912151207 1:106860788-106860810 GAGGAGGGACGGAGGGAGGGAGG + Intergenic
913530991 1:119734202-119734224 CAGGGAGTCCTGAGGGAGGGAGG - Intronic
914334623 1:146703094-146703116 GAGGGGGTAATAAGGGAGTGAGG - Intergenic
915511464 1:156389044-156389066 GAGGGGGTTAAGAGGGAGGGAGG - Intergenic
915563265 1:156699955-156699977 GAGGGGGCAGTGAAGCAGGGCGG + Exonic
915599038 1:156910785-156910807 GAGGGGGTGCTGAGGACGGGAGG + Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915719707 1:157975830-157975852 GCTGGGGTACTGATGGTAGGTGG + Intergenic
916058549 1:161083993-161084015 CAGGGGATACTGATGGAGAAAGG - Intronic
917764187 1:178199275-178199297 GAGGGCGAGCTGAAGGAGGGTGG - Intronic
917930431 1:179818895-179818917 GAGGGGGAACTGGTGGAGAGAGG - Intergenic
918154356 1:181831181-181831203 GTGGGGGCGCTGCTGGAGGGTGG - Intergenic
919248465 1:195019947-195019969 AAGGGGGTTCTGATGGTGGCAGG + Intergenic
919727848 1:200895410-200895432 GAAGGGGCACAGAGGGAGGGAGG - Intronic
919851911 1:201678785-201678807 GAGGGGGGACAGACAGAGGGAGG - Intronic
920057488 1:203203045-203203067 GAGGGGATAAGGATGGAGAGAGG - Intergenic
920771753 1:208892992-208893014 GAGGGGTTACAGCTGGAGGACGG + Intergenic
920843049 1:209570954-209570976 GAGGTCATACTGTTGGAGGGTGG - Intergenic
920973617 1:210765242-210765264 CAGGGGGTAATGGTGGCGGGTGG + Intronic
921303477 1:213772591-213772613 GAGGGGACACTGGTGGGGGGTGG - Intergenic
922272024 1:224043482-224043504 GAGGGGGGAGTGTTGGAGGGAGG - Intergenic
922272123 1:224043773-224043795 GGGGGAGTACTGATGGGGAGAGG - Intergenic
922272185 1:224043945-224043967 GAGGGGGTGCTGGTGGGGAGGGG - Intergenic
922406298 1:225316647-225316669 GAGGGAGAACTGAAGCAGGGTGG - Intronic
922428048 1:225517913-225517935 GAGGAGGTGCTGAAGGAGGCTGG + Intronic
922586822 1:226739369-226739391 GGGGGGGTAGTGGAGGAGGGAGG + Intergenic
922855592 1:228772671-228772693 TCGGGGGTAGTGATGGGGGGTGG + Intergenic
924726589 1:246677021-246677043 GAGGGGCAAAGGATGGAGGGAGG + Intergenic
1062834683 10:627899-627921 GGTGGGGGACTGATGGTGGGAGG - Intronic
1064048822 10:12042854-12042876 GAGGGGGAGCTGAGGGAAGGCGG - Intronic
1064492925 10:15878513-15878535 GAGGGGGAGCTGAAGCAGGGCGG - Intergenic
1065905627 10:30248535-30248557 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1067332353 10:45333919-45333941 GAGGGTGAACTGAGGCAGGGTGG - Intergenic
1067705212 10:48601588-48601610 GAGTGGGTGCTTATGGATGGTGG - Intronic
1067752179 10:48978728-48978750 GAGGAGGTAATGATGGGGGCGGG - Intronic
1068047847 10:51910249-51910271 GTGGGGGTACTCTAGGAGGGAGG + Intronic
1068983045 10:63081443-63081465 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1070152061 10:73811311-73811333 GAGGCGGTTCTGAGGGAGGCCGG + Intronic
1070450767 10:76554849-76554871 GAGAGGGCACTCATGGTGGGTGG + Intronic
1070942660 10:80360176-80360198 AGTGGGGTAGTGATGGAGGGTGG - Intronic
1072788379 10:98300336-98300358 GCGAGGGTCCAGATGGAGGGAGG + Intergenic
1073082121 10:100866964-100866986 GAGGGGATTCTGGTGCAGGGCGG - Intergenic
1073287774 10:102398867-102398889 GAGGGGGTACTGATGGAGGGAGG + Intronic
1073336691 10:102714922-102714944 GGGGGAGTACCGATGGGGGGAGG + Intronic
1073486183 10:103820510-103820532 GAGGGGGCACTGGGGGAGGAGGG - Intronic
1075058518 10:119238052-119238074 GAGGGGGTGCTGATCTAGGGAGG + Intronic
1076109161 10:127848232-127848254 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1076795405 10:132795608-132795630 CAGGGGGGACTGATGGGGCGGGG + Intergenic
1077657065 11:4029553-4029575 GAGGAGGGACGGAAGGAGGGTGG + Intronic
1077704423 11:4470981-4471003 GATGGGGAAGTTATGGAGGGTGG - Intergenic
1077901801 11:6496164-6496186 GAAGGATTACTTATGGAGGGAGG + Intronic
1078855601 11:15204476-15204498 GAGGGGGTGTGGGTGGAGGGTGG - Intronic
1079407545 11:20159306-20159328 GAGGGGGGACAGAAGGAGAGAGG + Intronic
1082857093 11:57817754-57817776 GAGGGGGCAATACTGGAGGGAGG - Exonic
1084178419 11:67435101-67435123 GAGGGGGGACGGATGGGGAGAGG - Exonic
1085047681 11:73362954-73362976 GATGGGGTGCTGGTGGAGTGGGG + Intronic
1087374626 11:97326041-97326063 GATAGGGTACTGATAGAGGTGGG + Intergenic
1088506855 11:110535411-110535433 GCGGGGGTGGGGATGGAGGGTGG + Intergenic
1088812581 11:113401519-113401541 GAGGGGGTGATGATGGTGAGGGG + Intergenic
1089238503 11:117053646-117053668 GAGGGGGTAGGGTGGGAGGGGGG - Intronic
1089492620 11:118893373-118893395 GTGGTGGTGCTGATGAAGGGAGG - Intronic
1089645422 11:119875698-119875720 GAGGCGGGGCTGATGGAGGGAGG - Intergenic
1090472187 11:126990294-126990316 GAGGGGATCCGGATGAAGGGTGG - Intronic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1090949868 11:131464096-131464118 GAGGGGCTGCTGAGGGAGGAGGG + Intronic
1091301818 11:134512772-134512794 GAAGAGGTACAGATGGAGGAGGG - Intergenic
1091760479 12:3084153-3084175 GTAGGGGTCCTGGTGGAGGGCGG - Intronic
1091842882 12:3633282-3633304 GAGGGGGTACTCATTGAAGAGGG + Intronic
1091913773 12:4252676-4252698 GAGGGGGTGTTGATGGTGAGGGG - Intergenic
1092045482 12:5429727-5429749 GAGGAGGGACTGAGGGAAGGAGG - Intergenic
1092238243 12:6822724-6822746 GAGGAGGGACTGGAGGAGGGAGG - Intronic
1092489732 12:8934331-8934353 GAGGCGGTACTGAAGGGGCGGGG - Exonic
1092673605 12:10890925-10890947 GAAGGGGTGCTGAGGGATGGAGG - Intronic
1092975803 12:13743881-13743903 GATGGGGTCCAGATGGAGGTAGG - Intronic
1094423836 12:30298917-30298939 GAGGAGGTAAGGATGGAGAGGGG + Intergenic
1094788745 12:33883710-33883732 TAGGGTCTATTGATGGAGGGAGG + Intergenic
1095095900 12:38149074-38149096 AAGGGAGTAGTGAGGGAGGGAGG - Intergenic
1095606492 12:44073651-44073673 GAGGAAGTACTGTTGGAGGTTGG + Intronic
1096071486 12:48777871-48777893 GAGGGGGCTCTGATGGGGGAAGG - Intronic
1096946270 12:55412609-55412631 GAGGCGGTACTGAAGGGGCGGGG + Intergenic
1097246424 12:57610160-57610182 GAGGGGGCACTGAAGCTGGGGGG - Exonic
1097323098 12:58246844-58246866 GAGGGGGTGGTGGTGGGGGGTGG + Intergenic
1097381441 12:58900019-58900041 GCAGGGGTAATGATTGAGGGGGG - Intronic
1097752675 12:63374832-63374854 GAGGGGGCAGTGAAGGAAGGAGG - Intergenic
1099236185 12:80084562-80084584 GAGGGCGAACTGAAGCAGGGTGG - Intergenic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1100209018 12:92381914-92381936 GAGGGGGGATGGAGGGAGGGAGG + Intergenic
1100370792 12:93967011-93967033 GAGGGAGTATAGAGGGAGGGAGG - Intergenic
1102390174 12:112543307-112543329 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1102394355 12:112574540-112574562 GAGGGGGTGATGGAGGAGGGAGG + Intronic
1102394396 12:112574674-112574696 GAGGGGGTGGTGGAGGAGGGAGG + Intronic
1102437487 12:112936641-112936663 GAGGGGGTACCTATGCAGAGTGG - Intergenic
1102877107 12:116457262-116457284 GTGGGGGTAGCGATGGGGGGTGG + Intergenic
1102886400 12:116525383-116525405 GGGGAGGGACTGAGGGAGGGAGG - Intergenic
1103533601 12:121619705-121619727 GAGGGGGTAGGAGTGGAGGGAGG + Intergenic
1103555940 12:121766494-121766516 CAGGGGTTACTGCTGGTGGGAGG - Intronic
1104191105 12:126482510-126482532 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1104197817 12:126558119-126558141 GAGGTGCTAGTGCTGGAGGGTGG - Intergenic
1106186197 13:27412090-27412112 GTGGGGGTGAGGATGGAGGGTGG + Intergenic
1106394545 13:29367432-29367454 GAGGAGGCACTGGTGGAGGCAGG + Intronic
1106730797 13:32539536-32539558 GATGGGGAACCAATGGAGGGAGG - Intergenic
1107417678 13:40216550-40216572 CAGGGGGTGTAGATGGAGGGAGG - Intergenic
1108430194 13:50345838-50345860 GAGGGGGGAGTGAGGGAGGGAGG - Intronic
1108436575 13:50406776-50406798 GAGGGGGGAAAGAAGGAGGGAGG - Intronic
1108523397 13:51264390-51264412 GAGGAGGGACTGATGCAGAGGGG - Intronic
1108706174 13:52990293-52990315 GAGGTGGTATTGATGTAGGGTGG - Intergenic
1110889825 13:80684820-80684842 GGGTGGGTACAGAAGGAGGGAGG + Intergenic
1111779429 13:92702838-92702860 AAGGGGGAAGTCATGGAGGGAGG - Intronic
1112280794 13:98061339-98061361 GCGGGGGTGTTGGTGGAGGGAGG - Intergenic
1112620232 13:101047220-101047242 GAGGGGGAACAGAAGCAGGGTGG - Intergenic
1114225572 14:20735069-20735091 CAGGGGCTATTGATGGAGGCAGG - Intronic
1114227027 14:20748084-20748106 CAGGGGCTATTGATGGAGGCAGG - Exonic
1114255935 14:21001389-21001411 GAGGGGACTCTGAAGGAGGGCGG + Exonic
1114487153 14:23069625-23069647 GAGGGGGGAGTGGTGGTGGGGGG + Intronic
1114534258 14:23412948-23412970 GAGAGGGGTCTGATGGTGGGGGG + Intronic
1114615318 14:24065111-24065133 GAGGGGGTGGGGGTGGAGGGAGG - Exonic
1115785395 14:36820053-36820075 GAGAGGGAACTGATGGAGACTGG + Intronic
1116892650 14:50283462-50283484 TAGGGGGTAGTGCTGGTGGGAGG - Intronic
1117378789 14:55139340-55139362 GAAGGGGAACTGATGGGGGAGGG + Intronic
1117747658 14:58887311-58887333 TGGGGGGTACTGATGGAAGGAGG - Intergenic
1118121974 14:62855947-62855969 GAGTGGATACTACTGGAGGGTGG - Intronic
1119024555 14:71142238-71142260 GTGTGGTTACTGATGGTGGGAGG - Intergenic
1120101954 14:80455091-80455113 GTGGGGGAAATGATGGAGAGTGG - Intergenic
1120764068 14:88312360-88312382 GAGAAGCTGCTGATGGAGGGAGG - Intronic
1122279125 14:100610799-100610821 GAGGGGGTACTGAGGGGAGCAGG + Intergenic
1122690116 14:103528307-103528329 GAGGAGGTGCTGCTGGAGGATGG - Intergenic
1122775185 14:104113855-104113877 GAGGGGCTGCAGGTGGAGGGAGG + Exonic
1122900834 14:104781701-104781723 GGGGGGATGCTGGTGGAGGGTGG + Intronic
1122916304 14:104860594-104860616 TAGAGGGTGGTGATGGAGGGTGG - Intergenic
1122916435 14:104861171-104861193 CAGAGGGTAGTGATGGATGGTGG - Intergenic
1122916457 14:104861288-104861310 TAGAGGGTAGTGATGGACGGTGG - Intergenic
1123468172 15:20531234-20531256 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123634747 15:22293028-22293050 GAGGGAGTAGTGAGGGAGGTAGG + Intergenic
1123649943 15:22469830-22469852 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123728488 15:23126444-23126466 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123740346 15:23278649-23278671 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123746652 15:23323909-23323931 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124278920 15:28347225-28347247 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124303779 15:28564383-28564405 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1125174980 15:36810943-36810965 GAGGGGGTACAGATGTGAGGTGG - Intergenic
1125720269 15:41841991-41842013 GAGGAGGTGCAGAGGGAGGGAGG - Intronic
1125929409 15:43589835-43589857 GAGGGGGTCCTGTGGGAGGATGG - Intronic
1125942576 15:43689667-43689689 GAGGGGGTCCTGTGGGAGGATGG - Intergenic
1126690654 15:51286641-51286663 AAGGGGGTACTCATGGTGGAAGG - Intronic
1128252616 15:66173678-66173700 GGAGGGGTAATGGTGGAGGGAGG - Intronic
1128462572 15:67882380-67882402 GAGGGGGAAGGGATGGAGGAAGG + Intergenic
1129068732 15:72933237-72933259 GAGTGGGGAGGGATGGAGGGAGG + Intergenic
1129161860 15:73752075-73752097 GTGGGGGTTCTGAGGGAAGGCGG - Intronic
1129849521 15:78784404-78784426 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
1129893910 15:79090018-79090040 GAGGGGGCAGGGATTGAGGGCGG - Intronic
1130405602 15:83598174-83598196 GAAGGGGTACTGAGTGAGTGTGG - Intronic
1131081372 15:89539105-89539127 GAGGGGGGAGGGAAGGAGGGAGG + Intergenic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1132539963 16:504128-504150 GAGGGGGTACAGGAGGAGGTGGG - Intronic
1132647272 16:1004880-1004902 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647318 16:1005015-1005037 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647334 16:1005059-1005081 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647379 16:1005176-1005198 GAGGGGGTAGAGATGGGGGGAGG + Intergenic
1132715848 16:1289448-1289470 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1132734165 16:1377458-1377480 GAGGGAGGACTCAGGGAGGGAGG - Intronic
1132764225 16:1526300-1526322 GAGGGGGGGCTGTGGGAGGGGGG - Intronic
1134885782 16:17790233-17790255 GAAGGGAGACTGATGGATGGAGG + Intergenic
1135393850 16:22115945-22115967 GAGGGGGTGGGGAGGGAGGGAGG + Intronic
1135852308 16:25975290-25975312 GAGGGGGAAGGGAGGGAGGGAGG + Intronic
1135927702 16:26709857-26709879 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1138120103 16:54393861-54393883 GAGGGGGTTTTGTTGGGGGGCGG + Intergenic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138431191 16:56970150-56970172 GAGGGTGTATTGATGGGAGGGGG - Intronic
1138505335 16:57475697-57475719 GAGGGGGGAGAGAGGGAGGGAGG - Intronic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1139480610 16:67228576-67228598 GATGGGGCCCTGATGGATGGTGG + Exonic
1139998998 16:71008138-71008160 GAGGGGGTAATAAGGGAGTGAGG + Intronic
1140596874 16:76426120-76426142 TATGGGGTACTGGTGGAGTGGGG + Intronic
1140814010 16:78604669-78604691 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814018 16:78604684-78604706 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814026 16:78604699-78604721 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814034 16:78604714-78604736 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814042 16:78604729-78604751 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814050 16:78604744-78604766 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814058 16:78604759-78604781 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814066 16:78604774-78604796 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814090 16:78604824-78604846 GAGGGGGGAAGGAGGGAGGGAGG - Intronic
1141428819 16:83960526-83960548 GAGGGGCTGCTGGAGGAGGGCGG - Intronic
1141537753 16:84694660-84694682 GAGGGGGAAGGGAGGGAGGGGGG + Intergenic
1141670081 16:85487023-85487045 CAGGGGGTTCTGATACAGGGAGG + Intergenic
1141993484 16:87622994-87623016 GAGGGGGACCTGGTGGAGGTCGG + Intronic
1142126274 16:88412128-88412150 GGTGGGCTCCTGATGGAGGGTGG - Intergenic
1142228126 16:88887345-88887367 GAGGGGCTGATGAGGGAGGGAGG - Intronic
1142541240 17:661066-661088 GAGGAGGGAGGGATGGAGGGAGG - Intronic
1143584368 17:7844042-7844064 GGGGGGGTCCTGAGGGAGGGAGG - Intronic
1144085715 17:11806932-11806954 GAGGAGAGGCTGATGGAGGGTGG + Intronic
1144278782 17:13703303-13703325 GGGGGGGAAGTGAGGGAGGGGGG + Intergenic
1144278787 17:13703318-13703340 GAGGGGGGACTGAGGGAGCGGGG + Intergenic
1144874611 17:18390906-18390928 GAGGTGGTAATGCTGGTGGGGGG - Intergenic
1144942046 17:18948566-18948588 GGGTGGGGAGTGATGGAGGGTGG + Intergenic
1145157615 17:20553515-20553537 GAGGTGGTAATGCTGGTGGGGGG + Intergenic
1145284867 17:21497929-21497951 GAGGGAGAACTGAAGAAGGGTGG + Intergenic
1145956427 17:28858016-28858038 GGGGAGGTACTGAAAGAGGGTGG + Intronic
1146693192 17:34890731-34890753 GAGGGGGTACTGCTCAATGGAGG - Intergenic
1146927564 17:36755475-36755497 GAGGGGGTGCAGAGGGAGTGGGG + Intergenic
1147147143 17:38491829-38491851 AAGGTGCTACTGGTGGAGGGCGG + Intronic
1147176584 17:38659544-38659566 GAGGAGGAAGGGATGGAGGGAGG + Intergenic
1147228586 17:39000760-39000782 GAGGGGGTCCTGTGGGAGGATGG - Intergenic
1147453567 17:40520848-40520870 GAGGGGGTGCTGGTGGAGGTGGG + Intergenic
1147755117 17:42762464-42762486 GTAGGGGCAGTGATGGAGGGTGG + Intronic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1148749273 17:49935363-49935385 TGGGGGGTGGTGATGGAGGGAGG + Intergenic
1149447576 17:56725524-56725546 GAGGGGGTACTCAGGGAGAGGGG + Intergenic
1149848543 17:60021568-60021590 GAGGTGGTAATGCTGGTGGGGGG + Intergenic
1149861626 17:60124956-60124978 GAGGTGGTAATGCTGGTGGGGGG - Intergenic
1150262410 17:63805424-63805446 GATGGGCTAGTGATGAAGGGTGG + Intronic
1150612079 17:66741488-66741510 GAGGACGAAGTGATGGAGGGAGG + Intronic
1151401366 17:73857996-73858018 GAGGGGGCCCTGAGGGAGGAGGG - Intergenic
1151720842 17:75855123-75855145 GAGGGAGCACTGATGGAGTGAGG - Intronic
1152036063 17:77874009-77874031 GAGGGGCTACTGGTGCAGGAAGG - Intergenic
1152813013 17:82391096-82391118 GAGGAGGTGCTGAGGGAGGAGGG + Intronic
1153675308 18:7451794-7451816 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1153728382 18:7980999-7981021 CAAGGGGAACTGATGGAGAGGGG - Intronic
1153870628 18:9316174-9316196 GAGGGGGGAAGGAGGGAGGGAGG + Intergenic
1154321449 18:13356722-13356744 CAGGGGGTGCTCCTGGAGGGAGG - Intronic
1155008146 18:21748360-21748382 GAGGGGGGAGAGAGGGAGGGAGG - Intronic
1155008151 18:21748375-21748397 GAGGGGGGAGAGAGGGAGGGGGG - Intronic
1155550428 18:26959315-26959337 GAGGGAGGAGTGATGGAGGTGGG + Intronic
1156992012 18:43420397-43420419 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1157301791 18:46484715-46484737 GAGGTGGCTCTGATGGAAGGAGG + Intronic
1157444023 18:47731455-47731477 CTGGGGGTACTGTTGGAGGCTGG - Intergenic
1158275295 18:55760504-55760526 GAGGAGGGTCTGATGGAGAGAGG - Intergenic
1160356143 18:78229684-78229706 GAGGGAGGAAGGATGGAGGGAGG - Intergenic
1161116824 19:2501870-2501892 GAGCGCAGACTGATGGAGGGAGG - Intergenic
1161375587 19:3937744-3937766 GAGCGGGTATTGCAGGAGGGCGG - Intronic
1161375605 19:3937790-3937812 GAGCGGGTATTGCAGGAGGGCGG - Intronic
1161375657 19:3937928-3937950 GAGCGGGTATTGCAGGAGGGTGG - Intronic
1161375774 19:3938250-3938272 GAGCGGGTATTGCAGGAGGGTGG - Intronic
1161384391 19:3983283-3983305 GAGATGGCACTGATGGAGGGAGG + Exonic
1161526560 19:4759731-4759753 GAGCGGGAGCTGAGGGAGGGAGG + Intergenic
1161607372 19:5222482-5222504 GAGGGGGCAGTGGTGGGGGGCGG + Intronic
1161682090 19:5685147-5685169 GTGGGGGTGCTCATGGGGGGTGG + Intronic
1162070929 19:8151637-8151659 GTGGGGTTCCTGTTGGAGGGTGG + Intronic
1162435424 19:10654948-10654970 GAGGGGGTAGGGAAGGAGTGAGG - Intronic
1162879709 19:13648955-13648977 GAGGGGGGAAGGAAGGAGGGAGG + Intergenic
1163472595 19:17506033-17506055 CAGGGGGTGCTGCTGGAGGGAGG - Exonic
1163644340 19:18479922-18479944 GAGTGGGTGCTTCTGGAGGGTGG - Intronic
1164025353 19:21346646-21346668 AAGGGGGTAGGGAGGGAGGGAGG + Intergenic
1164383800 19:27756673-27756695 GAGGGGGCAATACTGGAGGGAGG - Intergenic
1165420215 19:35718498-35718520 GACGGGGCACGGAGGGAGGGCGG + Intronic
1165656091 19:37533425-37533447 AAAGGGGTACTGAAGGAGGCTGG + Intronic
1165670273 19:37672399-37672421 TAGGGGGGAGGGATGGAGGGAGG + Intronic
1165759711 19:38313808-38313830 TGGGAGGTGCTGATGGAGGGAGG - Intronic
1165910058 19:39220194-39220216 GCGAGGGTATAGATGGAGGGAGG + Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166068042 19:40371564-40371586 GAGGGGGTACTGTGGGACAGGGG + Intronic
1166777561 19:45322189-45322211 GAGAGGGCACTGAGGCAGGGTGG + Intronic
1166998910 19:46733369-46733391 GACGGGGAACTGCTGGAGCGAGG - Intronic
1167250200 19:48395265-48395287 ATGGGGGGACTGATGCAGGGAGG - Intronic
1167250438 19:48396159-48396181 GAGGAGGTAGAGATGGAGGCGGG + Intronic
1167298923 19:48668060-48668082 GAGGAGGGGCTGTTGGAGGGAGG + Intronic
1167566634 19:50261308-50261330 GAGGGGGTGATGGGGGAGGGAGG - Intronic
1168128400 19:54300047-54300069 GGGGGGGGAGTGAGGGAGGGAGG - Intergenic
1168135589 19:54349218-54349240 GAGGGTGGATGGATGGAGGGAGG + Intergenic
1168135655 19:54349492-54349514 GAGGGTGGACGGATGGAGGGAGG + Intergenic
1168137038 19:54359086-54359108 GAGGGGGTCCGGATGGAGCACGG + Intronic
1168143971 19:54408720-54408742 GAAGGGGTAGGGAGGGAGGGAGG + Intergenic
1168161043 19:54510043-54510065 GAGGGGGTCCGGATGGAGCACGG - Intronic
925164987 2:1710507-1710529 GAGTGGGTCCTGGTGGAGAGTGG - Intronic
925164997 2:1710554-1710576 GAGAGGGTGCTGGTGGAGAGTGG - Intronic
925165008 2:1710601-1710623 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165012 2:1710618-1710640 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165018 2:1710650-1710672 GAGCGGGTGCTGGTGGAGAGTGG - Intronic
925165027 2:1710697-1710719 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165047 2:1710774-1710796 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165059 2:1710821-1710843 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165078 2:1710900-1710922 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165092 2:1710962-1710984 GAGCGGGTGCTGGTGGAGAGTGG - Intronic
925165104 2:1711009-1711031 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165117 2:1711071-1711093 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165128 2:1711120-1711142 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165132 2:1711137-1711159 GAGCGGGTGCTGGTGGAGAGTGG - Intronic
925165140 2:1711169-1711191 GAGCGGGTGCTGGTGGAGAGTGG - Intronic
925165152 2:1711216-1711238 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165166 2:1711278-1711300 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165170 2:1711295-1711317 GAGCGGGTGCTGGTGGAGAGTGG - Intronic
925165182 2:1711342-1711364 GAGCGGGTGCTGGTGGAGAGTGG - Intronic
925165195 2:1711404-1711426 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165206 2:1711453-1711475 GAGCGGGTGCTGGTGGAGAGTGG - Intronic
925165218 2:1711500-1711522 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165232 2:1711564-1711586 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165240 2:1711596-1711618 GAGTGGGTGCTGGTGGAGAGTGG - Intronic
925165244 2:1711613-1711635 GAGCGGGTGCTGGTGGAGAGTGG - Intronic
925171016 2:1750565-1750587 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
925171031 2:1750592-1750614 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
925171048 2:1750623-1750645 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
925304721 2:2840006-2840028 GAGGGGGAACAGAAAGAGGGGGG + Intergenic
926049794 2:9737535-9737557 GAGGGGTTACTGGGGGAGTGAGG - Intergenic
926188035 2:10707010-10707032 GAGTGGGCACGGATGCAGGGAGG + Intergenic
926269474 2:11354345-11354367 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
926707042 2:15844238-15844260 CAGGTGGAACTGATGGATGGGGG + Intergenic
926878901 2:17518591-17518613 GAGGAGGGACTGAGGGAGGCGGG - Intergenic
927236492 2:20880154-20880176 GAGGGCGTATTGATGGCAGGAGG - Intergenic
927316839 2:21693225-21693247 AAGGGAGCCCTGATGGAGGGGGG - Intergenic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
927848713 2:26485667-26485689 GAGGAGGGAGTGAAGGAGGGAGG - Intronic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
928858467 2:35827961-35827983 GATGGGGTAGTGGTGGGGGGTGG + Intergenic
929171110 2:38934423-38934445 GAAGGGGGAGGGATGGAGGGAGG - Intronic
929171132 2:38934488-38934510 GAAGGGGGAGGGATGGAGGGAGG - Intronic
930622533 2:53658907-53658929 AAGGGGGGAGTGAGGGAGGGAGG + Intronic
930764756 2:55073921-55073943 CAGGTGGTCCTGAGGGAGGGTGG - Intronic
931221304 2:60290613-60290635 GAGGGGGAACTAAAGGAAGGTGG + Intergenic
932196041 2:69784929-69784951 GAGGTGATACTGGTGTAGGGTGG - Intronic
934077581 2:88441070-88441092 GAGGGGCTACAGATGGTGAGTGG + Intergenic
935600640 2:104918464-104918486 GAGGCCATACTGGTGGAGGGTGG + Intergenic
936401431 2:112167482-112167504 GAGGGGGTCCTGCTGCAGCGAGG - Intronic
937095587 2:119233227-119233249 ATGGGGGTACTCATGGAAGGAGG - Intronic
937280197 2:120712545-120712567 GAGGGTGGAGTGATGGTGGGAGG - Intergenic
937448135 2:121975808-121975830 GAGGGGGTGGTGATGGAGCCAGG + Intergenic
939158882 2:138561864-138561886 GAGGGGGTAGAGAGGGAGGGGGG - Intronic
945038401 2:205723990-205724012 GAGGGTGTACAGGTGAAGGGGGG + Intronic
945195576 2:207234540-207234562 GAGGGGGTAGGGATGGTGGGGGG - Intergenic
945599698 2:211845242-211845264 GTGGGGATAGTGATGGAGCGTGG - Intronic
946106599 2:217375830-217375852 GAGTAGGAACTGATGGTGGGAGG - Intronic
946394565 2:219436635-219436657 GAGGAGATGCCGATGGAGGGAGG - Intronic
947661192 2:231869954-231869976 GAGGGGGGAGGGAAGGAGGGAGG - Intergenic
948075594 2:235163044-235163066 GCGGGGGTGCTGGTGGCGGGGGG + Intergenic
948111689 2:235461475-235461497 GAGGTGTTACTGGTGTAGGGTGG + Intergenic
948547804 2:238745295-238745317 GTGTGGGCAATGATGGAGGGTGG - Intergenic
948557098 2:238820574-238820596 TAGGGGCTACTGGCGGAGGGAGG + Intergenic
949033842 2:241807644-241807666 GAGGGGGGAGGGAGGGAGGGTGG - Intergenic
949033958 2:241807925-241807947 GAGGGGGGAGGGAGGGAGGGTGG - Intergenic
949034023 2:241808089-241808111 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1168991353 20:2098547-2098569 GAGGGTGTGTTGATGGGGGGAGG - Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169457215 20:5762449-5762471 GAGTGGGTAATGATGTAGAGGGG + Intronic
1169620020 20:7495477-7495499 GAGGGGGTACATATGCAGGTTGG - Intergenic
1170096252 20:12648892-12648914 GAGGGGGGAGTGTGGGAGGGAGG - Intergenic
1170483779 20:16794512-16794534 GAAGGGGTCCTTAGGGAGGGTGG - Intergenic
1170938246 20:20827872-20827894 GAGGGGGAAGGGAGGGAGGGAGG + Intergenic
1171896644 20:30814947-30814969 GAGGGGGTCGTGATGGATTGAGG - Intergenic
1172661389 20:36571760-36571782 GACGGGGTAGTGGTGGAGGGAGG - Intergenic
1172973465 20:38889759-38889781 GAGGAGGGAATGAGGGAGGGAGG + Intronic
1174191887 20:48746595-48746617 GAGGGAGGACTGACTGAGGGGGG + Intronic
1174280726 20:49437294-49437316 GAGGGAGAACTGATGGGGGCTGG + Intronic
1175221211 20:57417536-57417558 GATGGGGAATGGATGGAGGGAGG + Intergenic
1175768561 20:61608064-61608086 GAGGGGAGAATGATGGAAGGGGG - Intronic
1175892851 20:62323033-62323055 GAGGGGGGACTGATTGTGGGGGG + Intronic
1175971605 20:62689360-62689382 GAGGAAGGACTGATGGAGAGAGG - Intergenic
1175984069 20:62755465-62755487 GAGGGAGGATGGATGGAGGGAGG - Intronic
1175984081 20:62755496-62755518 GAGGGAGGATGGATGGAGGGAGG - Intronic
1175984103 20:62755566-62755588 GAGGGAGGATGGATGGAGGGAGG - Intronic
1175984110 20:62755585-62755607 GAGGGAGGGATGATGGAGGGAGG - Intronic
1175984139 20:62755667-62755689 GAGGGAGGATGGATGGAGGGAGG - Intronic
1175984199 20:62755838-62755860 GAGGGAGGATGGATGGAGGGAGG - Intronic
1176161957 20:63652817-63652839 GAGGGGGCGCTGAAGGAGGGGGG - Intronic
1176218325 20:63958545-63958567 GAGGGGGTAGGTTTGGAGGGAGG - Exonic
1179027739 21:37693811-37693833 AAGTGGGTACCGCTGGAGGGAGG - Intronic
1179517807 21:41921020-41921042 AAGGGGGTGCTGCTGGAGTGGGG + Intronic
1180051878 21:45335266-45335288 GAGGGGGCACAGATCCAGGGAGG - Intergenic
1180051923 21:45335379-45335401 GAGGGGGCACAGATCCAGGGAGG - Intergenic
1180076422 21:45465648-45465670 GAGGGGGCTGTGCTGGAGGGCGG + Intronic
1181033818 22:20160515-20160537 GAGGGGTTCCTGGTGGAGTGTGG + Intergenic
1181382871 22:22520863-22520885 GAGGGGGTAGTGAAGGAGGAGGG - Intergenic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1181509537 22:23382889-23382911 GAGGGGTTCCTCATGGAGTGCGG - Intergenic
1181769884 22:25117718-25117740 GAGAGAGTACTGATGGAGATGGG - Intronic
1181829279 22:25546484-25546506 GAGGAGGAAGGGATGGAGGGAGG - Intergenic
1181881979 22:25988424-25988446 AAGGGGGCAATGGTGGAGGGTGG + Intronic
1182003595 22:26940889-26940911 GTGGGGGCACAGAGGGAGGGAGG + Intergenic
1182864563 22:33592102-33592124 GAAGGGGGACAGAGGGAGGGAGG + Intronic
1182952665 22:34391842-34391864 CAGGGGGTAGTGATAGAGAGGGG - Intergenic
1183368158 22:37417974-37417996 GAGGGGGGACAGCAGGAGGGAGG + Intronic
1183694856 22:39415862-39415884 GAGGAGGTACTGCTGGAGACGGG + Intronic
1183848473 22:40562738-40562760 AAGGGGGAACGGACGGAGGGGGG + Intronic
1184099630 22:42335285-42335307 CAGGGGGTGCTGATAGAGGCAGG - Intronic
1184099663 22:42335477-42335499 GATGTGGTACTGATTGGGGGTGG - Intronic
1184248838 22:43249013-43249035 CAGGGGGTGCTGGTGGAGGAAGG + Intronic
1184291347 22:43499529-43499551 GAGGTGGTGGTGATGGTGGGTGG + Intronic
1184502235 22:44881034-44881056 GAGGAGGGAGGGATGGAGGGAGG - Intergenic
1184835505 22:47018746-47018768 GAGTGGGTCCTGGTGGTGGGCGG + Intronic
1185058333 22:48592654-48592676 GAGGAGGGAGTGAGGGAGGGAGG - Intronic
1185351990 22:50344053-50344075 GAGGGGGCACTGACTGGGGGGGG - Intronic
1185352227 22:50344807-50344829 GAGGGGGCACTGACTGGGGGGGG - Intronic
1185352383 22:50345310-50345332 GAGGGGGCACTGACTGGGGGGGG - Intronic
1185352396 22:50345343-50345365 GAGGGTGTACTGACTGGGGGGGG - Intronic
1185352534 22:50345770-50345792 GAGGGGGCACTGACTGGGGGGGG - Intronic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
953916304 3:46923129-46923151 GAGAGGGGAGTGATGGAGTGGGG - Intronic
953974976 3:47375590-47375612 GAGGGGTTGCAGATGGAGTGGGG - Intergenic
954436849 3:50500789-50500811 GAGGGGTTACTGCTGAAGGGAGG - Intronic
955705707 3:61725687-61725709 GTGGGGGTAGTGGTGGAGGTAGG - Intronic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
956603496 3:71048806-71048828 GGGGGGGTACAGCTGGAGGTGGG + Intronic
959383992 3:105678530-105678552 GAGGTGGGAGAGATGGAGGGAGG + Exonic
959736433 3:109664888-109664910 GAGGGTGTGCTGAAGCAGGGCGG + Intergenic
960854643 3:122090739-122090761 GCGTGGGTAGTGAAGGAGGGAGG + Intronic
961366229 3:126401691-126401713 GAGGGGGAGGAGATGGAGGGAGG + Intronic
961428538 3:126864261-126864283 GAGGAGGTGGTGATGGAGGAGGG - Intronic
961570585 3:127795395-127795417 GAGGGGGAAGGGAGGGAGGGGGG + Intronic
961660243 3:128464840-128464862 GAGGGGGAAGGGAGGGAGGGAGG - Intronic
962335577 3:134527411-134527433 GAAGGGGCACTGGTGGAGGCAGG + Intronic
962890917 3:139672288-139672310 GGGGGCGTACTGATGGAAGGGGG + Intronic
963641458 3:147865573-147865595 GAAGGGCTACTGATGGGGGAGGG + Intergenic
964682301 3:159355688-159355710 GAGGGGGTTTTGATGGGGTGGGG - Intronic
964783455 3:160366905-160366927 GAGGGGGTTGTGAGGGAGGTGGG - Intronic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
966126277 3:176580466-176580488 GAGGTGGAGGTGATGGAGGGTGG + Intergenic
966501416 3:180645462-180645484 GAGGAGGAACGGATAGAGGGAGG - Intronic
968356047 3:198108149-198108171 GCGGGGGTAGGGAGGGAGGGAGG + Intergenic
968953741 4:3707817-3707839 GAGGGGGTTCTGGAGGAGGCTGG + Intergenic
969229727 4:5821650-5821672 TAGTTGGTGCTGATGGAGGGAGG - Exonic
969486949 4:7477650-7477672 GAGGGGGCACAGAAGGCGGGAGG + Intronic
969704061 4:8782571-8782593 GAGGGGGAACTGGAGTAGGGAGG + Intergenic
970502335 4:16690515-16690537 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
970903700 4:21190509-21190531 GGGGGGGCACTGAGGGTGGGAGG + Intronic
971287929 4:25308176-25308198 GAGGGAGGAAAGATGGAGGGAGG + Intergenic
972074093 4:35061632-35061654 GAGGGGGGAGAGAGGGAGGGGGG + Intergenic
973019633 4:45186647-45186669 AAGGAGGGACGGATGGAGGGAGG - Intergenic
973157123 4:46969944-46969966 GGGGGGGCAATGGTGGAGGGAGG - Intronic
973818618 4:54642048-54642070 GAGGCGGGAATGATGGAGGATGG + Intergenic
975004925 4:69272182-69272204 GAGGGGGAACGGAGAGAGGGAGG - Intergenic
975425050 4:74215491-74215513 GAGGGCGAACTGAAGCAGGGTGG - Intronic
976263671 4:83170250-83170272 GAAGGGGTTATGATGGAGGTAGG - Intergenic
978706477 4:111718808-111718830 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
980196520 4:129596102-129596124 GGGGAGGGACTGAGGGAGGGGGG + Intergenic
980971078 4:139567801-139567823 TTGGGGGTAGTGGTGGAGGGTGG - Intronic
982580041 4:157164714-157164736 GTAGGGGTACTGATAGAAGGAGG + Intronic
984879752 4:184400196-184400218 GGGGAGGTACTGAAGGAAGGTGG - Intronic
985520647 5:372663-372685 GAGGCGGTGCAGACGGAGGGTGG - Intronic
986286776 5:6365123-6365145 CAGGGGGTACTGAGGGAGATGGG - Intergenic
986666397 5:10108443-10108465 GAGGGCGTACTGGGTGAGGGTGG - Intergenic
987447497 5:18038479-18038501 GAGGGAAGACTGATGGAGTGGGG - Intergenic
988603641 5:32662059-32662081 GAGGGGGCAATGATAGAGGAAGG - Intergenic
988815266 5:34828250-34828272 GAGGTGGTAATGATAGAGGCAGG + Intronic
989011440 5:36876841-36876863 GAGTCGGTACCGACGGAGGGAGG - Exonic
989090485 5:37725079-37725101 GAGGGGGTTCAGAGGCAGGGTGG + Intronic
991151422 5:63375836-63375858 GAGGGGGAGCTGAAGCAGGGTGG + Intergenic
991372702 5:65936145-65936167 GAGGGAGGTCTGATGGAGGGGGG + Intronic
992149895 5:73892471-73892493 GAAGGGGTCCTCATGGAGGAGGG - Intronic
993929151 5:93916672-93916694 TAGGGGGTTCTGAGGGAAGGGGG - Intronic
995229240 5:109739921-109739943 GAGGGCTGACAGATGGAGGGAGG + Intronic
995402323 5:111757237-111757259 GAGGGGGGATTGGGGGAGGGAGG + Intronic
995835808 5:116398366-116398388 TAGGGGCTTCTGAGGGAGGGAGG - Intronic
996195283 5:120598570-120598592 GAGGGGGCAGTGTTGGAGGGAGG - Intronic
997443457 5:133925161-133925183 GAGGGGGCCCTGTTGGAGGCTGG - Intergenic
997723208 5:136097432-136097454 GAGGGAGCACTGATGGAGGGAGG + Intergenic
997917723 5:137944950-137944972 GAGGGGGAAGGGAGGGAGGGGGG + Intronic
998091527 5:139373679-139373701 GAGAGGGCACTGAGGGAAGGTGG + Intronic
998527144 5:142853026-142853048 GAGGAAGTACTGATGAGGGGAGG + Intronic
998804058 5:145901146-145901168 GAGGGGGGAAGGAGGGAGGGGGG + Intergenic
999262158 5:150244931-150244953 GAGGGGGGACTGGAGGAGGGTGG - Intronic
999751666 5:154632220-154632242 GAGGGAGGAAGGATGGAGGGAGG - Intergenic
1000064222 5:157681278-157681300 GAGAGGTTACTGAGGGAGGCAGG - Intergenic
1001649183 5:173303226-173303248 GAGAGGGCACTGATCTAGGGAGG - Intergenic
1002399951 5:178986167-178986189 GAGGTGGGGCTGATGAAGGGAGG + Exonic
1002968123 6:1988384-1988406 GAAGGGGTACAGTTGCAGGGAGG - Intronic
1002979464 6:2121812-2121834 GGTGGGGTAGTGATGGTGGGTGG - Intronic
1003024952 6:2546438-2546460 GAGGGGGTGGTGATCGAGGAGGG - Intergenic
1003535003 6:6969100-6969122 GAGGGTGCCCTGAGGGAGGGAGG - Intergenic
1003812240 6:9796929-9796951 GAGGGGGAAGGGAGGGAGGGAGG + Intronic
1004632211 6:17432948-17432970 GAGGGGGGAGAGAGGGAGGGAGG - Intronic
1004899928 6:20184341-20184363 GAGGGGGGACAGGTGGAGGACGG + Intronic
1005024390 6:21448760-21448782 GAAGGGGTAGGGATGGAGGGTGG - Intergenic
1005223992 6:23620167-23620189 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1005232033 6:23713191-23713213 GAGGGGGTACTGATGCCATGTGG - Intergenic
1005839052 6:29728506-29728528 GAGAGGGTAAAGATTGAGGGAGG + Intronic
1005859833 6:29891681-29891703 GAGGAGGTAGGGAGGGAGGGAGG + Intergenic
1005979733 6:30827815-30827837 GATGGGGTGCTGGTGGGGGGTGG + Intergenic
1006911132 6:37564379-37564401 GAGGGGCTCTTGAAGGAGGGAGG - Intergenic
1007127130 6:39434830-39434852 GAGGGGGCAGAGATGGAGTGTGG + Intronic
1007292138 6:40796005-40796027 GAGGTGGTCCTGATGGAAGCTGG - Intergenic
1007473853 6:42106684-42106706 GTGGGGGTGCTGGGGGAGGGAGG + Exonic
1007740200 6:44005204-44005226 GTGGGGGTGCTGGGGGAGGGAGG + Exonic
1007782719 6:44263645-44263667 GAGGGGATACTGGGGGAGAGAGG - Intronic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1013754214 6:113441820-113441842 GAGGGAGGACTGGGGGAGGGAGG + Intergenic
1015528052 6:134192583-134192605 GAGGGGGGATGGATGGAGGTGGG - Intronic
1016205820 6:141467132-141467154 GAGGGGGAAATGATAGAGGCAGG - Intergenic
1016241425 6:141935722-141935744 GAGGGGATGCAGATGGAGGTGGG + Intergenic
1017445100 6:154500539-154500561 GAGAGGGAACTTAAGGAGGGAGG - Intronic
1017445818 6:154506316-154506338 AAGGAGGTAGTGAGGGAGGGAGG + Intronic
1017473701 6:154766644-154766666 GGGGGGGTGCTGCTGGAGGGAGG - Intronic
1017889941 6:158629635-158629657 AAGGGGCTGCTGATGGCGGGAGG + Intronic
1017931905 6:158963391-158963413 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1018639044 6:165890024-165890046 GAGGGAGGAGTGAGGGAGGGAGG - Intronic
1018788852 6:167130974-167130996 GAGGGGGTCCAGAGGGAGGGTGG - Intronic
1018844676 6:167547378-167547400 GAGGAGGGACTGATTGAGGAGGG - Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019219497 6:170463000-170463022 GAGGGGGAAGTGATGGGGAGGGG + Intergenic
1019549260 7:1594059-1594081 GAGGGAGGATAGATGGAGGGAGG - Intergenic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019772190 7:2890644-2890666 GAGCGGGTTCTGACGGAGAGGGG + Intergenic
1020369604 7:7417519-7417541 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
1020441522 7:8221890-8221912 GTGGGGGTAGGGACGGAGGGTGG + Intronic
1023856130 7:44185483-44185505 GAGAGGGGACAGATGGAGAGAGG - Intronic
1023910047 7:44547293-44547315 GAGGGGGAAGGGAAGGAGGGAGG + Intergenic
1024010367 7:45261221-45261243 CAGGGGGTAGTGGTGGAGGTGGG + Intergenic
1024548214 7:50539778-50539800 GACGGGCTACTGTTGCAGGGAGG - Intronic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1025064112 7:55838509-55838531 GAGGGGGGAGGGAGGGAGGGAGG - Intronic
1025209764 7:57013834-57013856 GAGGGGTCCCTGATGGAGGCTGG + Intergenic
1025662189 7:63563017-63563039 GAGGGGTCCCTGATGGAGGCTGG - Intergenic
1025881472 7:65541502-65541524 GAGAGGGTAGTGAAGCAGGGTGG + Intergenic
1025891967 7:65661113-65661135 GAGAGGGTAGTGAAGCAGGGTGG - Intergenic
1026112412 7:67469095-67469117 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1026638641 7:72105784-72105806 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
1027690462 7:81338352-81338374 TAGGGGGTGCTGATGGAAAGAGG + Intergenic
1028752228 7:94394408-94394430 GAGGGGGCAGAGAAGGAGGGAGG - Intergenic
1030512428 7:110500146-110500168 GAGGGACTACTGATGGATAGGGG - Intergenic
1031051507 7:116950348-116950370 GAGGGGGAAGGGAAGGAGGGAGG - Intergenic
1031756135 7:125645392-125645414 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1031808895 7:126341205-126341227 GAGGGTGTGCTGTGGGAGGGAGG - Intergenic
1032090552 7:128909644-128909666 GAAGGGGCACAGATGGAGGCAGG - Intronic
1032573014 7:133021346-133021368 GAGGGGGAACGGATGCCGGGTGG - Intronic
1032663556 7:134012547-134012569 GAGGGGGTTCAGATAGAGAGGGG + Intronic
1035776406 8:2191514-2191536 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1035776420 8:2191544-2191566 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1035776475 8:2191650-2191672 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1035783174 8:2244467-2244489 GAGGGGGTGGTGATGGGGGTGGG + Intergenic
1035808951 8:2475119-2475141 GAGGGGGTGGTGATGGGGGTGGG - Intergenic
1036111467 8:5907542-5907564 GAGGAGGAAGGGATGGAGGGAGG + Intergenic
1037035419 8:14160673-14160695 GATGGGGTATTGATAGATGGTGG + Intronic
1039087635 8:33795747-33795769 GAGAGGGTAGTGAAGGAGGGAGG - Intergenic
1039140637 8:34383914-34383936 GAGAGGGTACTGAGGGAGACAGG + Intergenic
1040279526 8:46031933-46031955 GTGGGGGAACGGATGGATGGAGG + Intergenic
1041198891 8:55430512-55430534 TATGGGGTAAGGATGGAGGGAGG + Intronic
1041303741 8:56438729-56438751 GGGGGGGTAGTGTTGGGGGGTGG + Intronic
1041585434 8:59512010-59512032 GATGGGCTACACATGGAGGGAGG - Intergenic
1043633346 8:82364388-82364410 GAAGGTGTACAAATGGAGGGGGG - Intergenic
1044326440 8:90864361-90864383 GTGGGGGGAAGGATGGAGGGAGG + Intronic
1045016232 8:98003800-98003822 GGTGGGGTGCTGATGGAAGGTGG + Intronic
1045017286 8:98010586-98010608 CAGGGGGTTCTGATGCTGGGAGG - Intronic
1045469817 8:102502145-102502167 GATGGGGGTCTGATGGGGGGGGG + Intergenic
1049161381 8:141100249-141100271 GATGGGGCACTGGTTGAGGGTGG - Intergenic
1049702418 8:144021220-144021242 GAGAGGGTCCTGAGGGAAGGCGG - Intronic
1049703056 8:144023715-144023737 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703237 8:144024373-144024395 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703244 8:144024389-144024411 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703290 8:144024525-144024547 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703345 8:144024748-144024770 GAGAGGGTCCTGAGGGAAGGAGG - Intronic
1049731458 8:144180628-144180650 GAAGGGGGGCTGTTGGAGGGAGG + Intronic
1050008872 9:1164311-1164333 GAGGGAGGAAGGATGGAGGGAGG - Intergenic
1050626534 9:7510152-7510174 GAGCGGGAAAGGATGGAGGGAGG + Intergenic
1050744187 9:8857916-8857938 AAGGGGGTAGGGGTGGAGGGAGG - Intronic
1051112165 9:13651411-13651433 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1051919444 9:22247688-22247710 GAGGGGGAACAGAGGGAGAGGGG - Intergenic
1053302735 9:36963378-36963400 GAGGGGGCAGTGTTGGATGGGGG - Intronic
1053337314 9:37286977-37286999 GAGGGGGGAGGGAGGGAGGGAGG - Intronic
1053442686 9:38128975-38128997 GTGGTTGTACTGATGGTGGGCGG + Intergenic
1053828130 9:42047602-42047624 GAGAGGGTAGTGGGGGAGGGAGG - Intronic
1054479123 9:65594156-65594178 GAGGGGGTGTGAATGGAGGGTGG + Intergenic
1057563314 9:96146077-96146099 ATGGGGGTACTGGTGGAGGAAGG + Intergenic
1057745226 9:97745820-97745842 GAGCAGGTAGGGATGGAGGGAGG - Intergenic
1059366299 9:113789130-113789152 GAGGAGGTAGTGAGGGAGGGAGG - Intergenic
1059435210 9:114271852-114271874 GAGGGGGTAACGAGGGTGGGCGG - Intronic
1060142971 9:121226460-121226482 GAAAGGGAACTGATGGATGGGGG + Intronic
1060513927 9:124254095-124254117 GAGGGGGTAATGGGGGAGAGAGG - Intergenic
1060735740 9:126065568-126065590 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1061009727 9:127947957-127947979 GAGGGGAGAGTGATGGTGGGAGG - Intronic
1061059759 9:128244607-128244629 GAGGAGGCACAGATGGATGGGGG - Intronic
1061105823 9:128529665-128529687 GAAAGGGTAGTGAGGGAGGGAGG - Intronic
1061328074 9:129876027-129876049 GAGGGGGCACTGATGGCTTGAGG + Intronic
1061339221 9:129965794-129965816 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
1061368860 9:130186820-130186842 GTGAGGGTGCTGATGGCGGGAGG + Intronic
1061401221 9:130369556-130369578 GAGGGGGAACTGTTGGGGTGGGG - Intronic
1061404233 9:130384831-130384853 GAGGGGTGACTGAAGGAGTGGGG - Intronic
1061898343 9:133660142-133660164 GTGCGGGTACTGCTGGAGCGGGG - Intergenic
1062005552 9:134236932-134236954 GTGGGGGTGCTCCTGGAGGGAGG + Intergenic
1062050564 9:134444552-134444574 GAGGGGGAAAGGAGGGAGGGAGG - Intergenic
1062144736 9:134982750-134982772 GAGGTTGTACTGAGGGGGGGTGG - Intergenic
1062174467 9:135153321-135153343 GAGGAGGCTCTGAGGGAGGGAGG - Intergenic
1062201708 9:135306228-135306250 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1062325291 9:136009842-136009864 GAGGGGGTGCTGATGGGCGCAGG + Exonic
1062546975 9:137068249-137068271 GAGAGGGTACAGACAGAGGGAGG + Intronic
1062613756 9:137386979-137387001 GCGGGGGTGCTGAGGGAGGCAGG - Intronic
1062646442 9:137550810-137550832 GTGGGGGTACTGCTGGGGAGAGG + Intergenic
1203376521 Un_KI270442v1:381895-381917 GAGAGGGTAGTGATGGATTGAGG + Intergenic
1185512541 X:674206-674228 GAGGTTGTACTGGAGGAGGGTGG - Intergenic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1185798065 X:2983955-2983977 GAAGGGGTACTGCAGTAGGGTGG - Intergenic
1185918913 X:4067242-4067264 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1186469339 X:9809018-9809040 GAGGGAGTACTAATGGATGTAGG - Intronic
1186801095 X:13092940-13092962 GAGGGGGCAGGGGTGGAGGGCGG + Intergenic
1186953694 X:14656491-14656513 GATGGGGTACTAAAGCAGGGGGG + Intronic
1187464269 X:19514634-19514656 GAGGGGGGCCTGCGGGAGGGGGG + Intronic
1187505854 X:19877883-19877905 GTGGGGGCACTGCTGGAGGCTGG - Intronic
1187533416 X:20116506-20116528 GAGTGGGTACACATGGGGGGTGG - Intronic
1187681447 X:21771174-21771196 GAGGAGGAACTAGTGGAGGGTGG - Intergenic
1189239222 X:39512755-39512777 GAAGGGGCACTGATAGAGGGAGG + Intergenic
1190472519 X:50797033-50797055 GAGGGGGAAAGGATGGGGGGAGG + Intronic
1191204602 X:57820846-57820868 GAGGGGGTTCTGAATGAGGGGGG + Intergenic
1193081670 X:77412335-77412357 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1193330418 X:80229950-80229972 GAGGGGGAAATGATAGAGGGAGG + Intergenic
1193646698 X:84079160-84079182 GAGGGCGAGCTGAAGGAGGGTGG + Intronic
1195552126 X:106182717-106182739 GTGGGGGCACTGCTGCAGGGGGG + Intronic
1196645848 X:118116812-118116834 GGGGGGCTGCTGAGGGAGGGGGG + Intronic
1196724456 X:118883808-118883830 GAGGGGGGAGTGATAGAGAGAGG - Intergenic
1197066453 X:122238822-122238844 GAGGGGGTAATGATAGAGGCAGG + Intergenic
1197924044 X:131627777-131627799 GATGGAGTACTGATGGGAGGAGG + Intergenic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1199143166 X:144335053-144335075 GAGGGGGGAGGGGTGGAGGGGGG - Intergenic
1199388053 X:147246281-147246303 GAGGAGATACTAATGCAGGGAGG - Intergenic
1199833422 X:151565410-151565432 GAGTTGGCAGTGATGGAGGGAGG + Intronic
1200115108 X:153766483-153766505 GAGGGGGCAGGGATGGAGAGAGG - Intronic
1201696190 Y:16829102-16829124 GAGGAGAGACTGAGGGAGGGAGG + Intergenic