ID: 1073288242

View in Genome Browser
Species Human (GRCh38)
Location 10:102401023-102401045
Sequence CTTCAGAAGGAGGCGGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 250}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073288242_1073288261 21 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288261 10:102401067-102401089 GGGCACTTGAACAGGGTGGGGGG 0: 1
1: 0
2: 3
3: 20
4: 243
1073288242_1073288263 26 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288263 10:102401072-102401094 CTTGAACAGGGTGGGGGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 553
1073288242_1073288260 20 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288260 10:102401066-102401088 GGGGCACTTGAACAGGGTGGGGG 0: 1
1: 0
2: 2
3: 18
4: 307
1073288242_1073288251 0 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288251 10:102401046-102401068 GCTGGTCAGTCTCACCCTCAGGG 0: 1
1: 0
2: 0
3: 8
4: 146
1073288242_1073288255 14 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288255 10:102401060-102401082 CCCTCAGGGGCACTTGAACAGGG 0: 1
1: 0
2: 0
3: 9
4: 104
1073288242_1073288259 19 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288259 10:102401065-102401087 AGGGGCACTTGAACAGGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 223
1073288242_1073288250 -1 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288250 10:102401045-102401067 GGCTGGTCAGTCTCACCCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 148
1073288242_1073288252 1 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288252 10:102401047-102401069 CTGGTCAGTCTCACCCTCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 153
1073288242_1073288253 13 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288253 10:102401059-102401081 ACCCTCAGGGGCACTTGAACAGG 0: 1
1: 0
2: 0
3: 11
4: 123
1073288242_1073288262 25 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288262 10:102401071-102401093 ACTTGAACAGGGTGGGGGGAAGG 0: 1
1: 0
2: 2
3: 63
4: 557
1073288242_1073288258 18 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288258 10:102401064-102401086 CAGGGGCACTTGAACAGGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 149
1073288242_1073288257 17 Left 1073288242 10:102401023-102401045 CCCTCACCCGCCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1073288257 10:102401063-102401085 TCAGGGGCACTTGAACAGGGTGG 0: 1
1: 0
2: 1
3: 17
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073288242 Original CRISPR CTTCAGAAGGAGGCGGGTGA GGG (reversed) Exonic
900733132 1:4276084-4276106 TTGCAGAAGGAGGTGGGTGTGGG + Intergenic
900830863 1:4964407-4964429 CTTCAGAAGCATGTGAGTGAAGG - Intergenic
901326177 1:8366567-8366589 CTTCAGATGGAGCCAGGTGGAGG - Intronic
901425504 1:9180345-9180367 CTACAGAAGGATGAGGGGGACGG - Intergenic
901444696 1:9301001-9301023 CCTCTGAAGGATGGGGGTGAAGG + Intronic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901989067 1:13097771-13097793 TCCCAGAGGGAGGCGGGTGAAGG + Intergenic
901992746 1:13128996-13129018 TCCCAGAGGGAGGCGGGTGAAGG - Intergenic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
903812398 1:26042013-26042035 CTTGAGAAGGAGGGGTGGGAAGG - Intronic
904006107 1:27364156-27364178 CTCCAGGAGGGGGCTGGTGAGGG - Intronic
904464774 1:30701316-30701338 CTTCAGGAGGAGGAAGGGGAGGG - Intergenic
904467994 1:30719251-30719273 CCTCAGACTGAGGCGGCTGAGGG + Intronic
905310692 1:37046909-37046931 GGTCAGAAGGAGGAGGGGGAGGG + Intergenic
905827700 1:41038735-41038757 CTGCAGAAGGAGGTGGGATATGG - Intronic
907430841 1:54410326-54410348 CTCCAGAAGGAGGTGGTTAAAGG + Intronic
911795330 1:102068744-102068766 ATTCAGAAGGGGGAGGGTCATGG + Intergenic
912052188 1:105542863-105542885 CTTCACAGGGAGGCAGGAGAGGG + Intergenic
912304530 1:108553795-108553817 CTGGAGAAGGATGGGGGTGATGG + Intergenic
915484087 1:156208030-156208052 CTTCTCCAGGAGGAGGGTGAGGG - Intronic
919090490 1:192973139-192973161 ATTCAGAAGGGGGAGAGTGATGG - Intergenic
920017623 1:202926696-202926718 CTTCAGAAGGGTGAGGATGAAGG - Intronic
920537654 1:206749774-206749796 CTTCAGGAGGAAGAGGCTGATGG + Intergenic
920854446 1:209651683-209651705 ATTCTGAAGGAGGCTGGGGAAGG + Intronic
921301699 1:213757069-213757091 CTTGAGAAGGAGGAGAGAGATGG - Intergenic
922214664 1:223510493-223510515 CTTCACAAGGCGGCGGGGGGTGG + Intergenic
922597802 1:226827295-226827317 CATCAGAAGTAGGAGGCTGAGGG + Intergenic
923001246 1:230008111-230008133 CTCCAAACGGAGGCGGGAGAAGG + Intergenic
923626169 1:235615741-235615763 CACCAGGAGGAGGGGGGTGATGG + Intronic
924287337 1:242501447-242501469 CTAAGGAAGGAGGAGGGTGAAGG - Intronic
1062901356 10:1149072-1149094 CTCCAGAAGGAGGCTGGAGAGGG - Intergenic
1063167847 10:3479958-3479980 CTTCACATGGAGGCCTGTGATGG - Intergenic
1064226695 10:13492378-13492400 CTCCGAAAGGAGGAGGGTGATGG - Intronic
1065964797 10:30762429-30762451 CTTGAGAAGGTGGGAGGTGATGG - Intergenic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1068890555 10:62144388-62144410 CATCAGAAGGTGGAGGGTGGGGG + Intergenic
1069142345 10:64841573-64841595 CTTCAGAAGGAGGGTCATGAAGG - Intergenic
1070678949 10:78435314-78435336 CTGCAGAAGGAGGCCAGAGAGGG + Intergenic
1070708150 10:78656697-78656719 CTTCAGAAAGAAGCGTGTGTAGG - Intergenic
1070774197 10:79100304-79100326 CAGCAGAAAGAGGCAGGTGAGGG + Intronic
1070805232 10:79266945-79266967 GTCCAGAAGGAGGTGGGAGACGG - Intronic
1073288242 10:102401023-102401045 CTTCAGAAGGAGGCGGGTGAGGG - Exonic
1073369467 10:102974147-102974169 CTTCAGATGGAGGTGTGGGAGGG + Intronic
1074381467 10:112984241-112984263 CTTCTGAAGGGGGCTGGGGAAGG - Intronic
1077359664 11:2135155-2135177 CCTTCGAAGGAGGCGTGTGATGG + Intronic
1080947635 11:36992904-36992926 CTTCAGAATCAGCCGGGTGGTGG + Intergenic
1083616348 11:64028420-64028442 CTGCAGAGGGAGGAGGGAGAGGG + Intronic
1083642038 11:64150842-64150864 CTTCAGACCTGGGCGGGTGAGGG - Intronic
1083664110 11:64265427-64265449 ATCCAGCAGGCGGCGGGTGAGGG - Exonic
1084003829 11:66313131-66313153 CTGCAGTCGGAGGCGGGGGATGG - Intergenic
1084061356 11:66677598-66677620 CTCCGGAAGGAGGCGGGGCAGGG - Exonic
1086485731 11:87299315-87299337 CTTCACAAGGTGGCAGGAGAGGG + Intronic
1089222728 11:116888349-116888371 CTTCTGATGGAGGCGAGTGCTGG - Intronic
1090244614 11:125207015-125207037 CTTCAGGTGGCGGGGGGTGAGGG + Intronic
1090766944 11:129884662-129884684 CTTTAGAGGGAGGTGGGTGGGGG - Intronic
1091443123 12:527169-527191 CTTTAGCAGGTGGAGGGTGAAGG - Intronic
1095778699 12:46035904-46035926 CTTCACAAGGACGCGCATGAAGG - Intergenic
1096182211 12:49557248-49557270 CTTCGGCAGGCGGTGGGTGAGGG + Exonic
1097218306 12:57430910-57430932 CTTGGGAAGGAGGGGGGAGAGGG + Exonic
1099502912 12:83435725-83435747 CTTCACCAGGAGGCGGTAGAGGG - Intergenic
1102090316 12:110181852-110181874 CTTCAGAAGGAGGGGAGTGAGGG + Intronic
1102192755 12:111001464-111001486 CTTCAGAAGGAGGCGTCACATGG - Intergenic
1102273560 12:111561383-111561405 ATTCAGGAGGAGGTGGCTGAGGG + Intronic
1102353001 12:112208535-112208557 CTGCAATGGGAGGCGGGTGAGGG + Exonic
1102566032 12:113798118-113798140 CCCAGGAAGGAGGCGGGTGAGGG - Intergenic
1103292668 12:119859920-119859942 CTGGAGAATGAGGTGGGTGAGGG - Intronic
1103342799 12:120230073-120230095 CTGCAGAAGAAGGTGGGTGAAGG - Intronic
1106413508 13:29527012-29527034 CTTCAGGAGGACCCGGGTGCCGG + Intronic
1107424198 13:40276405-40276427 CAACAGAAGGAGCCCGGTGAAGG + Intergenic
1112020771 13:95369367-95369389 CTTCACAAGGCGGCAGGAGAGGG + Intergenic
1114418278 14:22558531-22558553 TTCCAGAAGGAAGCGCGTGATGG + Intronic
1115754815 14:36520012-36520034 CTTTAGGAGGAGGGGGCTGAGGG + Intronic
1117331853 14:54720553-54720575 CCTCAGGAGGAGGCTGGTAATGG - Intronic
1117440907 14:55758285-55758307 GCTCAGAAGGGGGTGGGTGAAGG + Intergenic
1117728661 14:58698880-58698902 CTTCAGAGGGAGACAGGTGGAGG + Intergenic
1119745244 14:77039168-77039190 CTTCTGAAAGAGGCAGGAGATGG + Intergenic
1120837724 14:89056449-89056471 CCTCAGAAGGAAGCTGGAGATGG - Intergenic
1121137332 14:91510404-91510426 CTTCCGACGGAGGCGGGAGGCGG + Intronic
1121914281 14:97821568-97821590 CTTCAGAAGGTGACAGGAGAGGG - Intergenic
1124048825 15:26176537-26176559 GTTCAGGAAGATGCGGGTGAGGG - Intergenic
1124432250 15:29617791-29617813 CTGCACAAGGTGGTGGGTGACGG + Intergenic
1124619231 15:31264672-31264694 TTTGAGAAGGAGGGGGATGAGGG + Intergenic
1124765959 15:32486659-32486681 CTACTGAGCGAGGCGGGTGAGGG + Intergenic
1125570170 15:40710829-40710851 CTTGAGAAGGTGGCAGGAGATGG - Intronic
1125990867 15:44106517-44106539 AATCAGAATGAGGCAGGTGAAGG - Intronic
1126774150 15:52085430-52085452 CTTCAGCAGGAGGCAGGAAAGGG - Intergenic
1127836226 15:62793160-62793182 CTTCTCAAGGAGGCTGCTGAGGG + Intronic
1128114383 15:65096139-65096161 CTTCAGAAGGAGGGCGGGCAAGG + Intronic
1128360509 15:66958416-66958438 CTGCAGATGGAGGGTGGTGATGG + Intergenic
1129432346 15:75508935-75508957 CTTCAGGAGGAGACTGATGATGG + Exonic
1130435690 15:83896901-83896923 CTTCACAAGGCAGCGGGAGACGG + Intronic
1132279449 15:100600842-100600864 TTTCAGAAGGAAGTGGGTGTAGG - Intronic
1132554854 16:567956-567978 CGTCACCAGGAGGCGGTTGAGGG - Exonic
1132814813 16:1820640-1820662 GTTCAGAAAGGGGCGGTTGAAGG + Intronic
1133791007 16:9009064-9009086 CTTTAGAAAGAGGCGTGTGAGGG - Intergenic
1135534111 16:23279432-23279454 TTACACAAGGAGGAGGGTGAGGG + Intronic
1138802345 16:60048504-60048526 CTTCAGAAGGATGGGGGCGGTGG + Intergenic
1141885486 16:86889096-86889118 CTTTAGCAGGAGGCTGGGGATGG + Intergenic
1143481637 17:7230561-7230583 CTCCAGAAGGAGAAGGCTGAGGG + Intronic
1143742854 17:8966539-8966561 CTGCAGAAGGATGCGGGTCAAGG - Intergenic
1144347158 17:14359705-14359727 CTTCAGCCGGGGGCTGGTGAAGG - Intergenic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1147298922 17:39508192-39508214 CTTCAGACGGCGGGGGGAGAAGG + Intronic
1147614854 17:41821806-41821828 CCTCCGGAGGAGGTGGGTGAAGG + Exonic
1149316435 17:55443360-55443382 CTTCAGAAGGAGACTGATCAGGG - Intergenic
1150595869 17:66604037-66604059 CTTCAGTGGGAAGCGGGGGAAGG - Intronic
1151351812 17:73536410-73536432 CCTCGGAAGGAGGCTGGAGAGGG - Intronic
1151532342 17:74714730-74714752 TGTCAGAAGGAGGAGAGTGAGGG - Intronic
1152183418 17:78839932-78839954 CTTTAGAAGGAGGAGGGAGCGGG - Intronic
1152628763 17:81400193-81400215 CTGCAGGAGGGGGCGGGGGAGGG - Intronic
1152823468 17:82449207-82449229 CTTCAGATGGAGGCGGGAGCTGG + Exonic
1155103934 18:22641889-22641911 CCTGAGAACGAGGTGGGTGAGGG - Intergenic
1156739739 18:40309726-40309748 CTTGAGTAGGACACGGGTGAGGG + Intergenic
1157528725 18:48404965-48404987 CTTCAGTAGGAGGCTGTGGATGG - Intronic
1158631475 18:59118831-59118853 CTTCAGAAGGTTGAGGGTGTGGG - Intergenic
1160417522 18:78721439-78721461 CTTCAGAAGGGGAAGGGAGAGGG + Intergenic
1160819711 19:1052344-1052366 CTTGAGGAGGAGGAGGGGGAGGG + Intronic
1161435252 19:4259015-4259037 CCTCAGAAGGCGGCTGGTGAGGG - Intronic
1162562368 19:11424076-11424098 CTTGGGAAGGAGGCCGGGGAGGG + Intronic
1162968250 19:14165806-14165828 CTTCCGAAGGAGGTGGGGCAGGG - Intronic
1163555488 19:17989997-17990019 CTTCAGAGGGAGGCAGATGATGG + Intronic
1165908987 19:39212365-39212387 ATTCTGAAGGAAGCCGGTGAAGG + Intergenic
1167695976 19:51015832-51015854 CCTCAGGAGGAGGGGGCTGAGGG - Intronic
1167722309 19:51187024-51187046 CATCAGAAGGAGGAGGATTACGG - Intergenic
927101724 2:19792720-19792742 CTTCACAAGGTGGCAGGAGAGGG + Intergenic
928013068 2:27628943-27628965 CGTCAGAAAGGAGCGGGTGAGGG - Intronic
929512689 2:42577249-42577271 CTTCAGAAGAATGCTGGAGAGGG + Intronic
932820577 2:74896252-74896274 CTTCAGAGGGTGGAGGGGGAAGG + Intergenic
934474080 2:94581172-94581194 CTACAGTAGGGGCCGGGTGAAGG - Intergenic
934534737 2:95123460-95123482 CTTCTGAAGGACGGCGGTGAAGG - Intronic
934556413 2:95289192-95289214 ATTAAGAAGGAAACGGGTGAAGG - Intronic
934660061 2:96138560-96138582 CTGCAGGTGGAGGCGGTTGAGGG - Intergenic
934851937 2:97707189-97707211 TGTTAGAAGGAGGAGGGTGAGGG + Intergenic
934909276 2:98235829-98235851 ATTCAGAAGGAGGCGTGTTTGGG - Intronic
936115479 2:109699356-109699378 CTGCACAGGGAGGCGGGTGGGGG - Intergenic
938692298 2:133802713-133802735 CTTTGAAAGGAGGAGGGTGAGGG + Intergenic
940081174 2:149803041-149803063 CTGCAGGAGGAGGCTGGTGGGGG - Intergenic
940545978 2:155085864-155085886 ACTCAGAAGGAGGAGGGTGGGGG + Intergenic
941295837 2:163736838-163736860 ATTCACAGGGAGGCGGGGGAGGG - Intergenic
945189038 2:207166958-207166980 GGTCAGAAGGAGGCGCGGGAGGG - Intronic
945882599 2:215341957-215341979 CTTCAGAGGGCGGCAGGAGAGGG + Intronic
946000779 2:216480508-216480530 ATTCAGAAAGAGGCTGATGAGGG + Intronic
946702793 2:222429297-222429319 ATTCAGTAGGAGGGTGGTGATGG + Intronic
947324469 2:228959419-228959441 CTGCAGAAGGAAGTGGGAGAGGG - Intronic
947800497 2:232926614-232926636 CTAGAGGAGGAGGCGTGTGAAGG - Intronic
948269722 2:236664974-236664996 CTACAGCAGGAGGGAGGTGATGG + Intergenic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1171031951 20:21684841-21684863 CTCCACTAGGAGGCGGCTGATGG - Intergenic
1173589209 20:44210945-44210967 CTTCTGAGGGGGGCGGGTGCGGG - Intergenic
1175460068 20:59145871-59145893 GTTGAGGAGGAGGAGGGTGAGGG - Intergenic
1175754520 20:61521024-61521046 CTTAATAAGGAGGTGGGTGCGGG - Intronic
1176062744 20:63179371-63179393 CTGCAGATGGCGGCGGGGGAGGG - Intergenic
1178152510 21:29811793-29811815 CTTCAGCAGAAGGCAGGAGAAGG - Intronic
1179521132 21:41945774-41945796 CTTCATAAGGCGGCAGGAGAGGG - Intronic
1180837099 22:18935348-18935370 CCTCAACAGGAGGCGGGGGAAGG - Intronic
1180968612 22:19803333-19803355 CTCCAGGAGGAGGCGAGTGGCGG + Intronic
1181064858 22:20300675-20300697 CCTCAACAGGAGGCGGGGGAAGG + Intergenic
1181267548 22:21639571-21639593 CTGCAGCAGGAGGCCGGAGAAGG + Intergenic
1181387975 22:22558556-22558578 AGTCAGAAGGTGGGGGGTGAGGG + Intronic
1182578904 22:31291945-31291967 CCACAGAAGGAGGCTGGGGAAGG + Intronic
1183895107 22:40962025-40962047 CTTTGGAAGGACGAGGGTGACGG - Intronic
1184453681 22:44597402-44597424 CTTCAGAAGGAGCCCAGTGCTGG - Intergenic
1185099039 22:48827901-48827923 CTTCAGGTGGAGGCGGGTGTGGG + Intronic
1203287192 22_KI270734v1_random:160647-160669 CCTCAACAGGAGGCGGGGGAAGG - Intergenic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950562590 3:13743379-13743401 CTCCAAAAGGAGGAGGGAGAGGG - Intergenic
957425567 3:80034961-80034983 CTGCTGAAGGAGGAAGGTGAAGG - Intergenic
961745595 3:129061891-129061913 CAGCAGAAGGTGGCGGGTGCGGG - Exonic
963076495 3:141352297-141352319 CCCCAGAAGGAGGCAGGTGCTGG - Intronic
969457359 4:7307633-7307655 CATCAGAGGGAAGCGGCTGAGGG + Intronic
969694048 4:8724997-8725019 CTTCAGCATGAGGAGGGTGGCGG - Intergenic
970022831 4:11588279-11588301 CTTCAGGAGGAGTCGGGAGATGG - Intergenic
970148943 4:13068856-13068878 CTGCAGAAGGAGCCAGGAGATGG + Intergenic
971367390 4:25988336-25988358 CCTGAGAACGAGGAGGGTGAAGG - Intergenic
973989430 4:56389189-56389211 CTTCAGAATAAGGCGGGGGCCGG + Intergenic
975573256 4:75838860-75838882 CTTGAGCAGGAGGAGGGTGTGGG + Intergenic
977151997 4:93524042-93524064 CATCAGCAGAAGGAGGGTGAGGG + Intronic
977474605 4:97489765-97489787 CTTCAGAAGGAGACCTTTGAAGG - Intronic
986305975 5:6517228-6517250 CTTGAGGAGGAGGCGTGGGAAGG + Intergenic
987623855 5:20371751-20371773 CTTGAGAACAAGACGGGTGATGG + Intronic
991615751 5:68495582-68495604 CTTGACAAGGAGGCCAGTGAGGG - Intergenic
996388019 5:122929154-122929176 CCTCTGAAGGAGGCTGGAGAGGG - Intronic
996485546 5:124029589-124029611 CTGCAGAATCAGGTGGGTGAAGG - Intergenic
996787589 5:127256956-127256978 CTTCATAAGGAAGAGGGAGATGG + Intergenic
998092555 5:139379832-139379854 GATCTGAAGGAGGGGGGTGAGGG + Exonic
999382191 5:151129178-151129200 CTACAGAAGGAGGCAGGGGCTGG - Intronic
999850241 5:155529700-155529722 CATCAGAAGGAGGAGGATGCTGG + Intergenic
1000480442 5:161767257-161767279 CTTCAGAAAGTGGCAGGTGAGGG - Intergenic
1000787515 5:165564159-165564181 CTTCACAAGGAGGCAGGAGGAGG + Intergenic
1001776167 5:174330696-174330718 GTTCAGGAGGAGGCAGGAGAAGG + Intergenic
1002772952 6:304777-304799 CTGCAGAAGGATGTTGGTGATGG - Intronic
1002863312 6:1099218-1099240 CTCCAGAAGAAGGCTGGTGTTGG + Intergenic
1005826405 6:29633579-29633601 GGTCAGAAGGAGGTGGGGGAGGG + Intronic
1005857029 6:29870435-29870457 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005862848 6:29914586-29914608 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1006634561 6:35452616-35452638 CTGCAGCAGGAGGCGGGCGGGGG - Exonic
1007180427 6:39925748-39925770 CTTCACAAAGAGCCGGGCGAGGG + Exonic
1007335139 6:41150370-41150392 CTTCTGAAGGAAGGGAGTGAGGG - Intronic
1007751202 6:44073031-44073053 CAGCAGAGGCAGGCGGGTGAGGG + Intergenic
1011548161 6:88502951-88502973 CTTCACAAGGTGGCAGGAGAGGG + Intergenic
1017571917 6:155754329-155754351 CTTCACAAGGTGGCAGGAGAGGG - Intergenic
1018496444 6:164351178-164351200 CTTAAGAAGGAGGAGTGGGAGGG + Intergenic
1020275657 7:6623007-6623029 TTTCAGGTGGAGGCGGGTGGGGG - Exonic
1021234990 7:18132074-18132096 TTTCAAAAAGAGGCGTGTGAAGG - Intronic
1021919293 7:25467929-25467951 CTACAGAGGGAGGTGGGTGGAGG - Intergenic
1023905218 7:44517003-44517025 CTTCAGAAGGAGAATGCTGAGGG + Intronic
1024193119 7:47032779-47032801 CTACAGAAAGAGGTTGGTGATGG + Intergenic
1024413571 7:49077256-49077278 CTTCAGAGAGAGGCAGCTGAAGG + Intergenic
1029029809 7:97455646-97455668 ATTCAGATGGAGGTGGGAGAAGG - Intergenic
1030885823 7:114935897-114935919 AATCATAAGGAGGCTGGTGAGGG - Intronic
1034432310 7:151047206-151047228 CTTCTCTAGGGGGCGGGTGAAGG - Intronic
1034441623 7:151088592-151088614 CTCCAGAAGGAGCTGGGGGAAGG - Intronic
1036332017 8:7836928-7836950 GTTCAGAAGGAGGAGGATGGGGG - Intronic
1037778078 8:21848903-21848925 CTTCAGGAGGTGGCAGGGGATGG - Intergenic
1037871718 8:22504042-22504064 TTTAAGAGGGAGGTGGGTGAAGG + Intronic
1038421357 8:27436046-27436068 CTTCAGAGGGAGCAGGGTGATGG + Intronic
1038734904 8:30160122-30160144 CTACAGAAGGATGGGTGTGAGGG - Intronic
1038740387 8:30211859-30211881 CTTCACAAGGTGGCGGGAGTGGG + Intergenic
1040071937 8:43195654-43195676 CTGGAGGAGGAGGAGGGTGAGGG + Intronic
1041674847 8:60527474-60527496 CTTCACAAGGCGGCAGGAGAGGG + Intronic
1041903049 8:63002869-63002891 TTTCAGAAGGAGTGTGGTGAAGG + Intergenic
1045244395 8:100430180-100430202 CTTCAGAAGAGCCCGGGTGATGG - Intergenic
1045264261 8:100605595-100605617 GTTCAGAAGGATGCGGTTGCTGG + Intronic
1047338560 8:123958367-123958389 CTCCAGCAGGAGGCGTGGGAGGG + Intronic
1049031517 8:140041569-140041591 CTGCAGAAGGGGTTGGGTGATGG - Intronic
1049602387 8:143513971-143513993 CTTCAGAAAGGGGCTGGTGGAGG - Intronic
1049624234 8:143612966-143612988 CTGCAGAGGCAGGCAGGTGAGGG + Intronic
1050144622 9:2553541-2553563 TTTCAGAGGGAGGCAGGAGATGG + Intergenic
1051616977 9:19015864-19015886 ATTCAGATGCAGGTGGGTGATGG - Intronic
1052296435 9:26900977-26900999 CTTCAGAATAAGGTGGGTAATGG - Intergenic
1053683997 9:40504960-40504982 CTACAGTAGGGGCCGGGTGAAGG + Intergenic
1053933971 9:43133245-43133267 CTACAGTAGGGGCCGGGTGAAGG + Intergenic
1054279724 9:63119993-63120015 CTACAGTAGGGGCCGGGTGAAGG - Intergenic
1054297092 9:63340424-63340446 CTACAGTAGGGGCCGGGTGAAGG + Intergenic
1054395112 9:64644932-64644954 CTACAGTAGGGGCCGGGTGAAGG + Intergenic
1054429759 9:65150132-65150154 CTACAGTAGGGGCCGGGTGAAGG + Intergenic
1054500624 9:65871400-65871422 CTACAGTAGGGGCCGGGTGAAGG - Intergenic
1056126246 9:83538446-83538468 CGACAGAAGGAGGCGGGGAAAGG - Intronic
1056938181 9:90933646-90933668 CTCCAGCAGGAGGCGGATGTGGG + Intergenic
1059277038 9:113106240-113106262 CTTCAAAAGGAGGCTCGTGCAGG - Intergenic
1059279213 9:113118311-113118333 CTTCAAAAGGAGGCTCGTGCAGG + Intergenic
1059671155 9:116493672-116493694 ATTCAGAAGCAAGAGGGTGAGGG - Intronic
1060995579 9:127873510-127873532 CTGCCGGGGGAGGCGGGTGATGG - Intronic
1061246193 9:129402240-129402262 CTTGAGAGGGAAGAGGGTGAAGG - Intergenic
1062126101 9:134863912-134863934 CTTCAGGTGGGGGCGGGGGAAGG - Intergenic
1062292828 9:135804941-135804963 CTTCAGGAGGAGGCTTGGGAGGG - Intergenic
1062540757 9:137040738-137040760 CTGCAGGAGGGGGCGTGTGAGGG + Intronic
1203489574 Un_GL000224v1:90656-90678 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1203502196 Un_KI270741v1:32544-32566 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1193847013 X:86484593-86484615 CTTTAGAAAGAAGTGGGTGAAGG + Intronic
1194657595 X:96592084-96592106 CCTCAGAAGGAGGAGCGTGGGGG + Intergenic
1195701409 X:107708386-107708408 CTTGAGAAGGATGGTGGTGATGG + Intergenic
1195814879 X:108873817-108873839 TATCACAAGGAGGAGGGTGAAGG - Intergenic
1195829495 X:109040263-109040285 CTCCAGGAGGAGGCGGGAAACGG - Intergenic
1196151579 X:112380693-112380715 CGTCAGAAAGGAGCGGGTGAAGG + Intergenic
1198573706 X:137987066-137987088 GTGCAGAGGGAGGTGGGTGAAGG - Intergenic