ID: 1073289997

View in Genome Browser
Species Human (GRCh38)
Location 10:102408821-102408843
Sequence GCGGCTTGTGGGAGGCACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073289997_1073290008 6 Left 1073289997 10:102408821-102408843 CCTCGGTGCCTCCCACAAGCCGC 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1073290008 10:102408850-102408872 GGTCGCCCCGCAACCTGGCGTGG No data
1073289997_1073290006 1 Left 1073289997 10:102408821-102408843 CCTCGGTGCCTCCCACAAGCCGC 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1073290006 10:102408845-102408867 CCCTCGGTCGCCCCGCAACCTGG No data
1073289997_1073290009 7 Left 1073289997 10:102408821-102408843 CCTCGGTGCCTCCCACAAGCCGC 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1073290009 10:102408851-102408873 GTCGCCCCGCAACCTGGCGTGGG No data
1073289997_1073290013 13 Left 1073289997 10:102408821-102408843 CCTCGGTGCCTCCCACAAGCCGC 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1073290013 10:102408857-102408879 CCGCAACCTGGCGTGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073289997 Original CRISPR GCGGCTTGTGGGAGGCACCG AGG (reversed) Intronic
900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG + Intronic
900685316 1:3944481-3944503 GGGGCATGTGGGAGGGACAGAGG - Intergenic
901020710 1:6253951-6253973 GCTGCTGGTGGGCGGCAGCGTGG - Exonic
901047283 1:6404782-6404804 GCGGCTTACGGGAAGCAACGCGG - Intergenic
901217273 1:7561786-7561808 TCTGCTTGTGGGAGGTAGCGTGG - Intronic
902379118 1:16044455-16044477 GCGGATAGAGGGAGGGACCGCGG - Intronic
902977030 1:20096302-20096324 GAGGCTTGTGGCAGGCACTAGGG - Intergenic
904009199 1:27380357-27380379 GCGCCTGGTGGGAGGAACAGTGG + Intronic
906797550 1:48710128-48710150 GCTGCTTGTGAGAGGCCCTGTGG - Intronic
909879748 1:80859573-80859595 ACAGCTTGTGGGAGGCAGGGTGG + Intergenic
911925790 1:103830777-103830799 GCTGCTTGTGGGAGCCAGGGTGG - Intergenic
913937267 1:125066056-125066078 GCGGCTTGGGAGAGGGGCCGCGG - Intergenic
915458376 1:156054828-156054850 GCGGCCCGCGGGAGGCACCTCGG + Exonic
919208963 1:194455103-194455125 GCGTGTTGTGGGAGGGACCTAGG - Intergenic
920997044 1:211003323-211003345 GTGACTTGTTGGAGGCACCTGGG - Intronic
921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG + Intergenic
922703503 1:227776135-227776157 GCGGCTTGTGGGACCCGCTGAGG - Intronic
922775788 1:228213744-228213766 GCGGCTTCGGGGAGGTAGCGGGG + Intronic
924500683 1:244635622-244635644 GCTGCTTCTGGGAGACACGGGGG - Intronic
924564982 1:245190026-245190048 ACGTGTTGTGGGAGGGACCGGGG - Intronic
1072741372 10:97911990-97912012 GCTGGTTGTGGGAGACACCACGG + Intronic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1074373881 10:112923008-112923030 GGGGATTGTGGGAGGCACTGTGG - Intergenic
1074481896 10:113830397-113830419 GCAGCTTTTGGGGGGCACAGTGG - Intergenic
1076064741 10:127440296-127440318 GCGGCCAGTGGGAGGCATCTGGG - Intronic
1076525939 10:131112408-131112430 AGGGCTTGTGGGAGGCACAGTGG - Intronic
1077269240 11:1667322-1667344 CCCGCTTGTGGGCGGCACTGAGG + Intergenic
1077370449 11:2179385-2179407 GAGGATGGTGGGAGGCACTGGGG + Intergenic
1077575620 11:3380827-3380849 GTGTGTTGTGGGAGGGACCGGGG + Intergenic
1079071470 11:17351631-17351653 GCCGCTCGCGAGAGGCACCGGGG + Intergenic
1082268408 11:50143763-50143785 ACGTCTTGTGGGAGGGACCTAGG + Intergenic
1083790050 11:64978791-64978813 GCGTGTTGTGGGAGGGACCCAGG - Intergenic
1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG + Intronic
1084719478 11:70895125-70895147 GCAGCCTTTGGGAGGCCCCGAGG + Intronic
1085084179 11:73655816-73655838 GCGGCTCCTGGGAGGGACGGTGG - Exonic
1089048788 11:115527844-115527866 GCAGCCTGTGGGAGGCAGAGGGG - Intergenic
1089603018 11:119626691-119626713 GCGGCTGGTGGGAAGAACTGAGG + Intronic
1089649434 11:119902997-119903019 ACGCATTGTGGGAGGCACCCAGG - Intergenic
1096221002 12:49828140-49828162 GCGGCTGGAGGGAGGGACGGAGG + Intronic
1100391235 12:94148099-94148121 GCGGCGAGAGGGAGGCCCCGGGG - Intergenic
1104595048 12:130115248-130115270 GGGGCTTGCGGGAGGCGGCGTGG - Intergenic
1104970904 12:132530274-132530296 CCGGCTGCTGGGAGGCACCTGGG + Intronic
1106076246 13:26463916-26463938 GAGGCTTGCTGGAGGCACAGGGG - Intergenic
1106633205 13:31498775-31498797 GCGTGTTGTGGGAGGGACCTAGG - Intergenic
1108484486 13:50910220-50910242 CCGGGTAGTGGGAGCCACCGGGG - Intronic
1114258144 14:21019563-21019585 GCGTCATGGGGGAGGCACAGAGG - Intronic
1116564770 14:46431686-46431708 ACGTGTTGTGGGAGGCACCCAGG - Intergenic
1117913661 14:60656403-60656425 CCCGCTTGTGGGAGCCACAGGGG - Intronic
1120765564 14:88324070-88324092 GAGGCTTGAGAGAGGCACGGGGG + Intronic
1127716176 15:61651391-61651413 GCAGCCTGTCTGAGGCACCGTGG - Intergenic
1129909012 15:79210758-79210780 GCTGCTTGTTGGAGTCACCTGGG + Intergenic
1131098181 15:89669204-89669226 GGGGCTTGTGGGAGACTCAGAGG + Intronic
1133772747 16:8877132-8877154 ACGGCTTGTGGGGGGCGCAGTGG - Intergenic
1134687680 16:16169988-16170010 GCTTCTGGTGGGAGGCACAGCGG - Intronic
1135594107 16:23728184-23728206 GAGGCTTGAGGGAGGCTCCTGGG + Intergenic
1136784236 16:32925309-32925331 GCGGCTCCTGGTAGGCAGCGTGG + Intergenic
1136885548 16:33928497-33928519 GCGGCTCCTGGTAGGCAGCGTGG - Intergenic
1138147317 16:54624407-54624429 GAGTCTTGTGGCAGGCACCAGGG + Intergenic
1141075758 16:81005655-81005677 GCTGCTTCTGGGAGGGACCCGGG + Intronic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG + Intergenic
1143027850 17:3951565-3951587 GTGGCAGGTGGGAGGCACTGGGG - Exonic
1143449617 17:7027966-7027988 GAGGCCTTTGGGTGGCACCGGGG + Exonic
1151048362 17:70948046-70948068 GCTGTGTGTGGGAGGCACAGTGG + Intergenic
1151349912 17:73525570-73525592 GCAGCCTGTGGGAGGCGGCGAGG + Intronic
1152157179 17:78642100-78642122 GGGGCTTGTGAGAGTCACAGAGG + Intergenic
1152846191 17:82601132-82601154 GGGTCTTGTGGGAGCCTCCGCGG + Intronic
1153773291 18:8432577-8432599 GTGGCTTCTGTGAGGCACCCTGG - Intergenic
1155507425 18:26547465-26547487 GCGACTTGTGGTAGGGCCCGAGG + Intronic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1158551269 18:58438180-58438202 GTAGATTGTGGGAGGCACAGAGG - Intergenic
1160904322 19:1445394-1445416 GCGGGAGGTGGGAGCCACCGCGG - Intergenic
1160911190 19:1474525-1474547 GTGGCTTGTGGGAGGAGCCCGGG + Exonic
1161055128 19:2187123-2187145 GCGACTTGTGGGGGGCTCCTGGG - Intronic
1161816269 19:6501857-6501879 GCAGCCCGGGGGAGGCACCGGGG + Intronic
1162070565 19:8149703-8149725 GCGGCTCGGGGGAGGGTCCGGGG + Exonic
1164177023 19:22784151-22784173 GCGGCTTGTGGGATGTGGCGGGG - Intergenic
1165827440 19:38713400-38713422 GCAGCTTGTGGGGGTCACAGAGG - Intronic
1166092628 19:40520051-40520073 TCGGCTTGTGGGAGGCGCGCAGG + Exonic
1166837587 19:45677050-45677072 GGTGCTCGTGGGAGGCTCCGAGG + Exonic
925912846 2:8584340-8584362 GAGGCCTGTGGAAGTCACCGAGG - Intergenic
929694240 2:44100581-44100603 GAGGCTTATGTGAGTCACCGTGG + Intergenic
931021153 2:58046670-58046692 GCGGCCTGTGTGAGGCTCCGCGG + Intronic
936938552 2:117860121-117860143 GCGGCAGGTGGAAGGCGCCGCGG - Intergenic
937230912 2:120397653-120397675 GCAGCTTGTGGGAGGCAGGTGGG - Intergenic
938540501 2:132280499-132280521 GGGGCTTGGGGGGGGCAGCGGGG + Intergenic
943090609 2:183370128-183370150 GCAGCTTGTGGGAGGCCCAGAGG + Intergenic
943589809 2:189784024-189784046 GCGGGTTGGGGGAGGCGCTGAGG - Intronic
947815711 2:233034832-233034854 GCGGGTTGAGGTAGGCACCCAGG - Exonic
948832337 2:240604135-240604157 GCGGCTTGGGGGAGACACCTGGG + Intronic
948853061 2:240717809-240717831 GCGGCCAGTGGAAGGCAGCGCGG - Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
1170458113 20:16552433-16552455 GCAGCATGTGGGAGGCCCAGAGG - Intronic
1171215039 20:23346167-23346189 GTGGCTTGTGTGAACCACCGTGG - Intergenic
1171249535 20:23637742-23637764 GCGCCTAGTGGGAGGCCCCATGG - Exonic
1172689340 20:36779519-36779541 GTGGCTTAAGGGTGGCACCGGGG + Exonic
1175195529 20:57240846-57240868 ACGTGTTGTGGGAGGCACCCAGG - Intronic
1175375215 20:58519436-58519458 GGGACTAGTGGGAGGCACCCAGG - Intergenic
1183440206 22:37818683-37818705 GCGGCTCCTGGGAGCCACAGGGG - Intergenic
1185035579 22:48475045-48475067 CCGGCCTGTGGGAGGCAGAGGGG - Intergenic
950012061 3:9731225-9731247 GGGGCTTGTGGGAGGGGGCGGGG - Intergenic
953826205 3:46253097-46253119 GCTGCATGTGGGAGTCACTGGGG - Intronic
953978290 3:47399196-47399218 GCAGCTTGTGGGAGCCAGCATGG - Intronic
954753695 3:52827709-52827731 GCCTCTTGTGGGAGGGAGCGGGG - Intronic
955528578 3:59848116-59848138 ATGGCTTGTGGGAGCCACGGTGG - Intronic
957733097 3:84168169-84168191 GCAGCTTGTGGGAGCCAGGGTGG - Intergenic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
959749337 3:109814571-109814593 GCAGCTTTTGGGAGGCAGTGTGG + Intergenic
967886413 3:194336670-194336692 GCGGCTAGAGGGAGGCTCAGAGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969577914 4:8047157-8047179 GCGGCATGTGGGTGGCGCCTGGG + Intronic
971599410 4:28573078-28573100 ACGGGTTGTGGGAGGGACCCAGG + Intergenic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
976818149 4:89174399-89174421 CCTGCTTGTGGGAGACACTGAGG + Intergenic
983000645 4:162409469-162409491 GCTGCTTCAGGGAGGCACAGTGG - Intergenic
986681704 5:10239228-10239250 TGGGCTTGTGGGTGGCACCCTGG - Exonic
991674101 5:69075169-69075191 GCGGGTGCTGGAAGGCACCGCGG - Intergenic
1007231301 6:40349298-40349320 GCGGGGTGTGGGAGGTGCCGGGG - Intergenic
1009905605 6:69867234-69867256 GCGGCTTCTGGGGGGCGGCGCGG + Intronic
1013611527 6:111800381-111800403 ACAGCTTGTGGGAGGCTCTGTGG + Intronic
1019082107 6:169441435-169441457 GCGGCAGGTGGGAAGCACCGAGG + Intergenic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1029374196 7:100168192-100168214 GGGGCTTGTTGGAGGGGCCGTGG - Intronic
1034461456 7:151200015-151200037 GAGGCTTGTGGGGGGCAGTGTGG + Intronic
1034618115 7:152436138-152436160 GCGGCTCGGGGGAGGGGCCGCGG - Intergenic
1035677745 8:1467245-1467267 GGGGCTGGGGGGAGGGACCGTGG - Intergenic
1038575553 8:28701313-28701335 GGGGATTGTGGGAGGCGCGGGGG - Exonic
1041958374 8:63582744-63582766 GGGGTTTGGGGGAGGCACTGAGG + Intergenic
1041984979 8:63910592-63910614 GCGTGTTGTGGGAGGGACCTGGG - Intergenic
1043516639 8:81000961-81000983 GAGGCTTGTGTGAGGAACCTAGG - Intronic
1045064224 8:98431302-98431324 GAGGCTTGTGGGAGGCTGGGAGG + Exonic
1045791526 8:105989611-105989633 GCTCCTTGTGGGAGGCAGTGGGG + Intergenic
1048319773 8:133389325-133389347 CTGGCTTGTGGGAGGCAGCAGGG - Intergenic
1048970848 8:139644193-139644215 GCAGCTTGTAGGAGGCAGTGTGG + Intronic
1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG + Intergenic
1053084306 9:35204936-35204958 GAGATTTGTGGGAGGCACAGAGG - Intronic
1058058613 9:100473441-100473463 GCGGCTGCTAGGAGGCACCGAGG + Exonic
1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG + Intergenic
1060196101 9:121624286-121624308 GCAGCTTGTAGGAGTCACAGAGG + Intronic
1060778604 9:126394997-126395019 GCGGCGTCTGGGAGGCCCCTTGG + Intronic
1060985793 9:127818293-127818315 GGGGCCTGAGGGAGGCACCGTGG - Exonic
1062150818 9:135018264-135018286 GTGGCTTGGGGGAGGGCCCGTGG - Intergenic
1062535040 9:137017707-137017729 GGGGCTTGGGGCAGGCCCCGGGG + Intronic
1062707515 9:137953619-137953641 GAGGCTTGGAGGAGGCACCGGGG + Intronic
1196745812 X:119070888-119070910 GAGCCCTGTGGCAGGCACCGTGG + Intergenic
1199849791 X:151717297-151717319 GCTTCTTCTGGGAGGCACCCCGG - Exonic