ID: 1073290489

View in Genome Browser
Species Human (GRCh38)
Location 10:102410883-102410905
Sequence CTGGAGGGCCTCAATGATGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073290489_1073290503 30 Left 1073290489 10:102410883-102410905 CCGCCATCATTGAGGCCCTCCAG 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1073290503 10:102410936-102410958 CTTCCCGATGTTCTAAGGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1073290489_1073290495 0 Left 1073290489 10:102410883-102410905 CCGCCATCATTGAGGCCCTCCAG 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1073290495 10:102410906-102410928 GTTCCCGATGAAGTCCCCGCAGG 0: 1
1: 0
2: 0
3: 0
4: 32
1073290489_1073290501 25 Left 1073290489 10:102410883-102410905 CCGCCATCATTGAGGCCCTCCAG 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1073290501 10:102410931-102410953 ATGCGCTTCCCGATGTTCTAAGG 0: 1
1: 0
2: 0
3: 1
4: 38
1073290489_1073290502 29 Left 1073290489 10:102410883-102410905 CCGCCATCATTGAGGCCCTCCAG 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1073290502 10:102410935-102410957 GCTTCCCGATGTTCTAAGGAAGG 0: 1
1: 0
2: 0
3: 0
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073290489 Original CRISPR CTGGAGGGCCTCAATGATGG CGG (reversed) Exonic
900422867 1:2563176-2563198 CTGCAGGGCCTCAATGACTGTGG - Exonic
901689659 1:10964468-10964490 CTGGAGGGCTTCCTTGGTGGGGG - Intronic
902490766 1:16779123-16779145 CTGGATGAGCTCATTGATGGGGG + Intronic
903337519 1:22635073-22635095 AGGGAGGGCCTCAAGGCTGGGGG - Intergenic
903577164 1:24346188-24346210 CAGGAGGGCCTCAATAAATGTGG - Intronic
903863223 1:26378358-26378380 CTGGCTGGCCTCAAGGTTGGAGG - Intergenic
904001229 1:27339913-27339935 TTTGAGGGCCTTAATGAAGGAGG + Intergenic
904287327 1:29461003-29461025 CTGGGAGGCCCCAGTGATGGTGG + Intergenic
904287506 1:29461750-29461772 CTGGAGGGCTTCTGGGATGGAGG - Intergenic
904655282 1:32040993-32041015 CTGTACTGCCTCACTGATGGAGG - Intronic
906310498 1:44750588-44750610 CTCCAGGGCCTCAAACATGGTGG - Intronic
906559707 1:46747400-46747422 TTGGAGCTCCTCAAGGATGGGGG + Intergenic
908658944 1:66417763-66417785 CTTGATGGCCTCAATCCTGGAGG + Intergenic
917568999 1:176244363-176244385 CCTGAGGGCCACAATGTTGGAGG - Intergenic
919403296 1:197146684-197146706 CCGGAGGTCCTCATTGGTGGAGG - Exonic
920515916 1:206584583-206584605 CTGGATGACCTCACTGACGGTGG - Exonic
923529678 1:234803412-234803434 CTGGATGAGCTCATTGATGGGGG - Intergenic
1063001110 10:1923959-1923981 CTGGTGGGCCTGGATGATGGAGG - Intergenic
1067576210 10:47410095-47410117 CTGGAGGGCCTCACTGCTCCAGG - Intergenic
1068089322 10:52413190-52413212 ATGGAGGGCTTCACAGATGGTGG - Intergenic
1070152644 10:73814434-73814456 CTGGAGGGCCTGAGTGACAGCGG - Exonic
1071147017 10:82587594-82587616 CTGGAGAGCCTGGATGATGTTGG - Intronic
1071547104 10:86537151-86537173 CTGGAAGGCCCCAGGGATGGTGG + Intergenic
1071835286 10:89411964-89411986 CTTGAGGGCCTCAATTCTAGAGG - Intronic
1072692954 10:97583669-97583691 CTGGAGGGGCCTAATGATAGTGG + Exonic
1073232566 10:101984557-101984579 CTGGAGTGGCTCAGTGTTGGTGG - Intronic
1073290489 10:102410883-102410905 CTGGAGGGCCTCAATGATGGCGG - Exonic
1074551221 10:114444242-114444264 CTGGAGGGCCTGAATGCATGTGG + Intronic
1075613265 10:123870731-123870753 CTGGAGGAGCTCAGTGATGAGGG - Intronic
1076576848 10:131475134-131475156 CTGGAGTGCCTCATGGATGTGGG - Intergenic
1076628780 10:131840127-131840149 GTGGAGGGCCTGATTGATGGAGG - Intergenic
1076994340 11:290845-290867 CTGCAGGGCCTCAGTGAGGCAGG - Exonic
1077108493 11:851960-851982 CTGGGGGTCCTCCATGAGGGCGG - Intronic
1078849742 11:15152745-15152767 CTGGAGGGCCTGAAAGCTGAAGG + Intronic
1082741771 11:56918742-56918764 CTGGGAAGCCTCAATGATGCTGG + Intergenic
1084658798 11:70535294-70535316 ATGGATGGACTGAATGATGGAGG - Intronic
1085420184 11:76351149-76351171 GTGGAGGGCTTCATAGATGGTGG + Exonic
1086520978 11:87667368-87667390 CAGGGGGGCCCAAATGATGGGGG - Intergenic
1087037907 11:93773095-93773117 AGGGAGGGCCTGAATGCTGGGGG - Intronic
1088597522 11:111451158-111451180 CTCTAGGGCCTCCATGATGATGG - Intronic
1091645717 12:2270885-2270907 CTGGAGGGGCTGGATGGTGGTGG + Intronic
1092788086 12:12047534-12047556 CTGGAGGTGTTCAAGGATGGTGG - Intergenic
1094236559 12:28174106-28174128 CTGGAGGGCCAAAGTGAGGGTGG + Intronic
1095561377 12:43570037-43570059 GTGGAGGGCTTCATAGATGGTGG + Intergenic
1095962625 12:47844962-47844984 CTGGATGGCCTCAATCAGCGCGG + Exonic
1098861820 12:75719042-75719064 CTGGAGGGCATGAAGCATGGGGG + Intergenic
1099377111 12:81904961-81904983 CTTGATGGCCTCAATGCTGGAGG - Intergenic
1099797909 12:87421778-87421800 CTTGATGGCCTCAATCCTGGAGG + Intergenic
1101322389 12:103684192-103684214 TTAGAGGGCATCACTGATGGTGG - Intronic
1103564650 12:121809615-121809637 CTGAAGCGCCTCAAGGATGGAGG + Exonic
1103602952 12:122065601-122065623 CTGCAGGGACTCAGTGAAGGAGG + Intergenic
1104833053 12:131767817-131767839 CTCGAGGGCTTCATTGAGGGTGG + Intronic
1107654015 13:42573974-42573996 TTGGAGGGCCCCCATGAAGGAGG + Intronic
1107654016 13:42573982-42574004 CTGAAGGGCCTCCTTCATGGGGG - Intronic
1109426227 13:62168425-62168447 AGGGAGGGCCTGAATGCTGGGGG + Intergenic
1112588595 13:100742882-100742904 TTCGAGGGCCTGAATGATTGGGG - Intergenic
1116326588 14:43538538-43538560 CTTGATGGCCTCGATCATGGAGG - Intergenic
1118630187 14:67695513-67695535 CTGGGGGGGCTCCAAGATGGCGG - Intronic
1119148831 14:72339944-72339966 CAGGAGGGCCGCAAAGAAGGAGG - Intronic
1120976838 14:90256538-90256560 CTGGCGGGCCGCAGTGGTGGAGG + Exonic
1121231993 14:92365031-92365053 CAGGAGGGCTTCAAGGGTGGAGG - Intronic
1121492791 14:94372058-94372080 CTGGAGGGGCTCCCTGTTGGAGG + Intergenic
1122341723 14:101032985-101033007 CTGGAAGGCCTGATGGATGGTGG + Intergenic
1126314832 15:47358751-47358773 CTGGGGGGACTCAATGAGGCAGG + Intronic
1128301580 15:66569522-66569544 AAACAGGGCCTCAATGATGGAGG - Intergenic
1129200754 15:73997823-73997845 CTGGAGGGCCTGAATAAATGGGG + Intronic
1129789825 15:78333361-78333383 CTGGAAGGCCTCGAGGATGAGGG - Intergenic
1133169789 16:3975087-3975109 CTGGAGAGCCACAGTGATGGGGG - Intronic
1135199294 16:20422891-20422913 CTGGAAGCACTAAATGATGGGGG + Intronic
1137916761 16:52440066-52440088 CAGGAGGGCATGAATAATGGTGG - Intronic
1138493955 16:57395687-57395709 CTTGATGGCCTCAATCCTGGAGG + Intergenic
1139515756 16:67451449-67451471 CTGGAGGGCCTGAAGGCTGTGGG + Intronic
1143158604 17:4854310-4854332 CTGGAGGTCTTCACAGATGGAGG - Intronic
1143202285 17:5121400-5121422 CTGCAGGGCCTCTGTGTTGGTGG - Exonic
1143477013 17:7208568-7208590 CTGGAGGGACTCGAAGATGAAGG - Intronic
1144627133 17:16849737-16849759 CTGCAGGGCCTCTGTGTTGGTGG + Intergenic
1144648137 17:16989280-16989302 CTGGGGTGTCTCAATGATGGGGG + Intergenic
1144879306 17:18422975-18422997 CTGCAGGGCCTCTGTGTTGGTGG - Intergenic
1145152932 17:20521412-20521434 CTGCAGGGCCTCTGTGTTGGTGG + Intergenic
1145800876 17:27683949-27683971 CTGGAGGGCCTGGATGAGAGCGG - Intergenic
1147581272 17:41628422-41628444 CTGCAGGGCCTCTGTGTTGGTGG + Intergenic
1148044668 17:44735846-44735868 CTGGAGGGCCAGGATGATGGTGG - Intronic
1148215263 17:45830650-45830672 CTGGGGGGCCTGAGGGATGGAGG + Intronic
1148786098 17:50146983-50147005 CTGTAGAGACTCAATGATGAAGG - Intronic
1149774440 17:59346186-59346208 CTGGAGGCACTAAATGGTGGTGG - Intronic
1155085891 18:22457678-22457700 CTGGGAGGCCTCAGGGATGGTGG + Intergenic
1156456917 18:37299948-37299970 CTGGAGGGTCTAGATGGTGGGGG - Intronic
1159088965 18:63824957-63824979 CTGCATGGCTTCAATTATGGTGG + Intergenic
1160220577 18:76974434-76974456 GAGAAGGTCCTCAATGATGGGGG - Intergenic
1161354419 19:3810951-3810973 CTGGCGGGCCTCGAAGGTGGCGG + Intronic
1161395795 19:4044229-4044251 CTGCATGGCCACAATGGTGGGGG + Intergenic
1161795135 19:6381945-6381967 CTGGGGGGCCTCACTGACTGGGG + Intronic
1166381481 19:42357390-42357412 CTGGGGGGCCTGAGGGATGGAGG - Exonic
1166645973 19:44532025-44532047 CTGGAAGGCCTATATGAGGGTGG - Intergenic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1167103397 19:47417494-47417516 CTGGAGGGCTTCAAGCTTGGGGG - Intronic
927484379 2:23478741-23478763 TGAGACGGCCTCAATGATGGAGG - Intronic
930346253 2:50185642-50185664 CTCAAAGGCCTAAATGATGGTGG + Intronic
935663007 2:105486070-105486092 CTGGAGGGCTTAGAGGATGGAGG + Intergenic
936802852 2:116287993-116288015 CTTGATGGCCTCAATCCTGGAGG - Intergenic
937947737 2:127355601-127355623 CTAGAGGGCCTCCATGTTGATGG + Intronic
938246246 2:129780024-129780046 CTGGGGAGCCTGAATGAGGGTGG - Intergenic
940147984 2:150567529-150567551 CTGCAGGGCCTCCCTGGTGGAGG + Intergenic
940660118 2:156535090-156535112 GTGTAGGGCCTGAATCATGGAGG + Intronic
941199188 2:162488458-162488480 CTGGATGGCCTGATTGATGGTGG - Intronic
942124379 2:172809088-172809110 CTGGGGGGCATCCATGATGGAGG + Intronic
945274550 2:207975193-207975215 CTCAAGGGCCTCAGTGATTGTGG - Intronic
945660638 2:212681335-212681357 TTGGAGGGGCAAAATGATGGAGG + Intergenic
947078537 2:226370047-226370069 CTGGGGGCCCTCACTGATGCTGG + Intergenic
1174401904 20:50280489-50280511 CTGGAGGGAGTCAATGGTGATGG + Intergenic
1175366881 20:58461730-58461752 CAGGATGGCCTCCTTGATGGAGG + Intronic
1179094102 21:38296644-38296666 ATAGCGGGCCTCAATGAGGGTGG + Intronic
1180612220 22:17105489-17105511 CTTGAGGGCTTTAATGATGTTGG - Intronic
1181570415 22:23765202-23765224 CTGGATGAACTCAATGAAGGCGG + Intronic
949390420 3:3556269-3556291 CTGGAAGGCATCGATGATGCCGG + Intergenic
949524241 3:4887780-4887802 CTGGAGGTGCTCAATGTTGTTGG - Intergenic
950766733 3:15278311-15278333 CTGGGGGGTCTCAGTGAGGGAGG + Intronic
953748020 3:45590127-45590149 CAGGAGGGCATCAAGGATTGTGG + Intronic
957625828 3:82650858-82650880 ATGGAGGGCCTGAAGGCTGGGGG + Intergenic
957865267 3:86014815-86014837 GTGGAGGGCTTCATAGATGGTGG - Intronic
960870777 3:122247678-122247700 ATGGAGGGGCTCCATGATGATGG - Intronic
961325044 3:126104750-126104772 CTGCAGGGCTTGAAAGATGGGGG + Intronic
961441635 3:126957080-126957102 CTGGAGGGCCCCCATGAGGATGG - Intronic
961725138 3:128923211-128923233 CTGGAGGGACCCAACCATGGAGG + Intronic
961783158 3:129333363-129333385 CTGGACTGCCTCAGTGAAGGTGG + Intergenic
962744802 3:138389401-138389423 CAGGAAGGGCTCAAAGATGGAGG + Intronic
962817915 3:139019800-139019822 CTGGAGGCCCTCTAGGATTGCGG - Exonic
966491472 3:180532052-180532074 ATGGAGGGCCTGAAGGCTGGGGG + Intergenic
972132868 4:35859684-35859706 CTTGATGGCCTCAATCCTGGAGG + Intergenic
975910270 4:79258708-79258730 ATGGAGGGCCTGAAGGCTGGGGG + Intronic
977359083 4:95981055-95981077 CAGGAGGGCCTGAAGGCTGGGGG + Intergenic
983784567 4:171715527-171715549 AGGGAGGGCCTCAAGGCTGGGGG + Intergenic
984670361 4:182477367-182477389 TTGCAGGGTCTCAATGAAGGTGG - Intronic
985711700 5:1433118-1433140 CTAGATGGCCTCAATGATCCTGG - Intronic
988616272 5:32778037-32778059 CTGGAGGGCGCCACTGAGGGAGG + Intronic
993138443 5:83999250-83999272 CTAGATAGCCTTAATGATGGTGG - Intronic
993763866 5:91831427-91831449 CTGGAGGGCCACAGTGAGTGGGG + Intergenic
994509408 5:100684720-100684742 CTGGATGGGCTCAAAGTTGGGGG - Intergenic
995811672 5:116114332-116114354 CTGGGTGGCCTCAGTAATGGTGG + Intronic
998534919 5:142920840-142920862 CTGGAGGGCCAGAATACTGGGGG + Intronic
999943951 5:156574909-156574931 CAACAGGGCCTCACTGATGGAGG + Intronic
1001338929 5:170825873-170825895 CTGGAGGACCTGAGTCATGGTGG - Intergenic
1002690935 5:181050114-181050136 CTTGAGGGCTTCAAGGAAGGAGG + Exonic
1003521404 6:6861576-6861598 CTGGATGGTTTCAGTGATGGAGG - Intergenic
1005194299 6:23265169-23265191 GTGGAGAGCCTCAATGAGCGAGG - Intergenic
1005813326 6:29532125-29532147 GGGGAGGGTCTCAATGCTGGGGG - Intergenic
1007030753 6:38623790-38623812 CTTGATGGCCTCAATCCTGGAGG - Intronic
1007792229 6:44316858-44316880 CTTGAGGGCCTCAATTCTAGAGG + Intronic
1010911713 6:81566435-81566457 CTGGTTGGTCTCAAAGATGGAGG + Intronic
1011224959 6:85095665-85095687 CTTGATGGCCTCAATCCTGGAGG - Intergenic
1011530169 6:88312637-88312659 ATGGAGGGCCTGAAGGCTGGGGG - Intergenic
1013755409 6:113455912-113455934 GAGGAGGCCCACAATGATGGTGG - Intergenic
1013943420 6:115693259-115693281 CTTGATGGCTTCAAAGATGGAGG - Intergenic
1016691707 6:146945143-146945165 CCAGAGGGCCTTAATGAAGGTGG - Intergenic
1018796552 6:167189938-167189960 GAGGAGGGCCTCACTGAGGGGGG + Intronic
1018819767 6:167365179-167365201 GAGGAGGGCCTCACTGAGGGGGG - Intronic
1019266547 7:120367-120389 CTGGAGTGCCTGAGTCATGGTGG + Intergenic
1019306331 7:337009-337031 CCAGAGGTCCTCCATGATGGTGG - Intergenic
1019912693 7:4110348-4110370 TTGGAGGCCATCAGTGATGGAGG - Intronic
1022537599 7:31107548-31107570 CTGGAAGGCATCCATGAGGGTGG - Exonic
1024433414 7:49318818-49318840 CTGGATGGCCTCCTTGTTGGTGG - Intergenic
1026386582 7:69855882-69855904 CTTCAGGGCCTCAGGGATGGTGG + Intronic
1029899413 7:104023093-104023115 CTGCAGGGCCCCAAAGAGGGAGG - Intergenic
1030711096 7:112750063-112750085 GTGGAGCACATCAATGATGGTGG + Intergenic
1031732315 7:125314594-125314616 CTTGATGGCCTCAATTCTGGAGG - Intergenic
1031779040 7:125939559-125939581 CTGGAGGGTCTGGAGGATGGTGG - Intergenic
1032665533 7:134032576-134032598 CTGGGGGGCCTCACTGGTGAAGG + Intronic
1034918637 7:155060955-155060977 CTTGATGGCCTCAGTGAAGGGGG + Intergenic
1035333785 7:158113002-158113024 CGGGGGGCCCTCAATGCTGGGGG - Intronic
1035721549 8:1796931-1796953 GTGCAGAGCCTCAATGCTGGTGG - Intergenic
1036586569 8:10129690-10129712 CTCCAGGGGCTCAAGGATGGAGG - Intronic
1042920298 8:73913341-73913363 CTTGATGGCCTCAATCCTGGAGG - Intergenic
1043192373 8:77241837-77241859 CTGGAAGCTCACAATGATGGTGG - Intergenic
1043303159 8:78760426-78760448 TTGGAGGGCTTCATAGATGGTGG + Intronic
1045057988 8:98385535-98385557 CTGGAGGTCCTCAGTCATTGAGG - Intergenic
1045858844 8:106793372-106793394 CTGGATGGCCTCAATCCTAGAGG - Intergenic
1049206445 8:141365809-141365831 CTGGAGGGCCTCCCTGAGGAGGG - Intronic
1049308933 8:141923240-141923262 CTGCTGGGCCTCACTGCTGGGGG - Intergenic
1057488155 9:95502207-95502229 CAGGATGGCCTCAAGGGTGGAGG - Intronic
1060983814 9:127808582-127808604 CTGGAGGCCCTCGAGGAAGGGGG + Exonic
1062401833 9:136376196-136376218 CTGGAGGGCCTCCATGACCCTGG + Intronic
1188528335 X:31110024-31110046 CTGGAAGGCCTCCAAAATGGTGG + Intronic
1189263238 X:39693000-39693022 ATGGAATGCCTCAATCATGGAGG - Intergenic
1190415977 X:50180801-50180823 CTGCAGGCTCTCATTGATGGAGG - Intergenic
1191988349 X:67005932-67005954 CTGGAGGGCCACAGTGATGTTGG + Intergenic
1192792531 X:74397154-74397176 GTGGAGGGCTTCATAGATGGTGG + Intergenic
1195995562 X:110728564-110728586 ATGGACGGGCTCAATGATGTCGG - Intronic
1200397572 X:156000272-156000294 CTGGACTGCCTCCATGATGGTGG + Intronic
1200776841 Y:7177020-7177042 CTTGATGGCCTCAATCCTGGAGG - Intergenic
1201455975 Y:14167143-14167165 CTTGATGGCCTCAATCCTGGAGG - Intergenic