ID: 1073290516

View in Genome Browser
Species Human (GRCh38)
Location 10:102410991-102411013
Sequence CCAGACATGCAGGACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073290516_1073290529 25 Left 1073290516 10:102410991-102411013 CCTCCCAGGTCCTGCATGTCTGG 0: 1
1: 0
2: 1
3: 22
4: 253
Right 1073290529 10:102411039-102411061 CCCGCCCGCCTCCACTCACATGG 0: 1
1: 0
2: 1
3: 13
4: 173
1073290516_1073290524 -4 Left 1073290516 10:102410991-102411013 CCTCCCAGGTCCTGCATGTCTGG 0: 1
1: 0
2: 1
3: 22
4: 253
Right 1073290524 10:102411010-102411032 CTGGCCAGGGGTTTGTTTTCCGG 0: 1
1: 0
2: 3
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073290516 Original CRISPR CCAGACATGCAGGACCTGGG AGG (reversed) Intronic
900589561 1:3453671-3453693 CCAGGGAGGCAGGTCCTGGGAGG + Intergenic
900949966 1:5853073-5853095 ACAGACATGAAGGAGCTGAGAGG + Intergenic
901228213 1:7626869-7626891 CCTGACTTGCAGGACCCTGGAGG + Intronic
902379008 1:16043918-16043940 CCAGACAGGCAGGGCGGGGGGGG + Intronic
902742100 1:18445867-18445889 CCAGACCTTCAGGACTGGGGAGG - Intergenic
903178254 1:21593105-21593127 CCAGACTGGCCGGCCCTGGGAGG + Intergenic
903273851 1:22208603-22208625 CCAGAGAGGCAGGACCTGTCTGG + Intergenic
903957480 1:27035330-27035352 CCAGACACGCAGAGACTGGGAGG - Intergenic
904295979 1:29519980-29520002 TCAGACATGGAGGTGCTGGGAGG + Intergenic
904367567 1:30024544-30024566 CCAACCATGGGGGACCTGGGTGG - Intergenic
904378290 1:30095308-30095330 CCAATCTTGCAGGGCCTGGGTGG - Intergenic
904532746 1:31180230-31180252 GGAGACATGGAGGAACTGGGGGG - Exonic
904629956 1:31833606-31833628 GCAGACATGCAGGGGCTGGATGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
907078015 1:51595445-51595467 ACAGAAATGCAGGGCCTGAGGGG + Intronic
911236923 1:95421937-95421959 CCAGAGGTGCGGGACATGGGAGG - Intergenic
913412198 1:118564383-118564405 GCAGACCTGCAGGGCCTGGCAGG + Intergenic
913437723 1:118864518-118864540 CCAGAAACACAGGACCTGGGAGG + Intergenic
914234445 1:145795412-145795434 CCAATCAAGCAGGACGTGGGCGG - Intronic
914384594 1:147156037-147156059 CATGGAATGCAGGACCTGGGAGG - Exonic
915300933 1:154951273-154951295 CCAGACACACAGGACCTGGAAGG - Exonic
915733752 1:158071796-158071818 CCAGGCAACCAGGACCTGAGAGG + Intronic
916207739 1:162331816-162331838 TCAGACCTGGAGGCCCTGGGGGG + Intronic
917692402 1:177482741-177482763 CCAGACATAGAGGAACTGGCAGG + Intergenic
917964233 1:180168316-180168338 CCAGACGGGCAGCACCTGGCAGG + Intronic
920313306 1:205061131-205061153 CCTGAGATGCTGGGCCTGGGAGG - Intronic
920851440 1:209630721-209630743 ACAGACATCGTGGACCTGGGAGG + Exonic
921319022 1:213919275-213919297 CCAGACTAACGGGACCTGGGGGG + Intergenic
922360804 1:224819659-224819681 CCAGATATGCAGGGCCTGGTAGG - Intergenic
922648239 1:227312879-227312901 CCAGCCATGCAGGACGGGGTCGG + Intronic
923017322 1:230136953-230136975 CCAGACACACAGGCCCTGCGTGG + Intronic
923895657 1:238267153-238267175 TCAGAGATCCAGGACCTGTGAGG - Intergenic
1066981558 10:42421221-42421243 GCAGACATGCAGGCCCAGTGTGG + Intergenic
1070518559 10:77230725-77230747 CCAAAGAGGCAGGAACTGGGAGG - Intronic
1073290516 10:102410991-102411013 CCAGACATGCAGGACCTGGGAGG - Intronic
1073450089 10:103604019-103604041 ACAGACATGGAGGATCAGGGAGG - Intronic
1075522981 10:123154994-123155016 GGAGACAAGCAGGAACTGGGAGG - Exonic
1076838559 10:133033354-133033376 TCAGACATGCAGGAGCTGAGTGG - Intergenic
1077108458 11:851823-851845 GCAGGCAGGCAGGTCCTGGGAGG + Intronic
1078667861 11:13341094-13341116 CCAGACAGGCAGGACAAGGTGGG - Intronic
1078886895 11:15509107-15509129 CCAGACATTCAGGGCCTCTGAGG + Intergenic
1079531195 11:21455976-21455998 GGAGAAATGCTGGACCTGGGAGG - Intronic
1080938554 11:36887660-36887682 CCAGACATGCGGAAAATGGGAGG + Intergenic
1083269172 11:61562666-61562688 CAAGCCCTGCAGGTCCTGGGAGG - Intronic
1083606323 11:63981043-63981065 CCACAAATGCAGGACATGGCAGG - Intronic
1083803000 11:65057640-65057662 CCAGACATGGAGGAAATGAGGGG - Intronic
1085051601 11:73382901-73382923 CCAGACTGGGAGGAGCTGGGTGG + Intronic
1085311276 11:75518314-75518336 CCAGGCAGGAAGGTCCTGGGGGG + Intronic
1086930817 11:92691046-92691068 CCGGCAGTGCAGGACCTGGGTGG - Intronic
1087946471 11:104165545-104165567 CCAGACTTTCAGGAGCTGGAAGG - Intergenic
1088423260 11:109671820-109671842 CCATTCATGCAAGACTTGGGTGG - Intergenic
1088541357 11:110917158-110917180 CCAGACTTGCAAGTCCTAGGAGG + Intergenic
1089072209 11:115709552-115709574 GCAGACATGCTGGGGCTGGGCGG + Intergenic
1089214863 11:116829352-116829374 CCAGAGATGGAGGTGCTGGGAGG + Intergenic
1089376697 11:117999773-117999795 CCAGCCCTGCAGGGCCTGGCTGG - Exonic
1091795741 12:3296613-3296635 GGAGAAGTGCAGGACCTGGGAGG + Intergenic
1095527381 12:43143427-43143449 CCAGAAATGCAGTACAGGGGAGG + Intergenic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1104289010 12:127451431-127451453 CCCGACATGCAGGACGTGCCTGG - Intergenic
1106993161 13:35448612-35448634 CCAGTCATGAAGGAACTTGGAGG + Intronic
1107117591 13:36763545-36763567 ACAGACATGCAGAACCTGGGTGG - Intergenic
1107661985 13:42648232-42648254 TTAGACATTCAGCACCTGGGTGG - Intergenic
1108154742 13:47573695-47573717 ACAGTCCTGCAGGGCCTGGGAGG - Intergenic
1108266952 13:48720416-48720438 GCAAACATGGAGGACCTGGAGGG + Intergenic
1111734177 13:92116039-92116061 CCAGACATTCAAGACCAGGCTGG + Intronic
1112344067 13:98576429-98576451 CCGGAGCTGCAGGCCCTGGGTGG - Intronic
1112606695 13:100913400-100913422 CCACAAAAGCAGCACCTGGGAGG - Intergenic
1113540113 13:111100637-111100659 CCACAGCTGCAGGACGTGGGAGG + Intergenic
1113991502 14:16030787-16030809 CCAGGCGTGCAGGGCCTGTGGGG + Intergenic
1114629796 14:24151659-24151681 CCAGACAAGCAGGTGCTGGGAGG + Exonic
1117252376 14:53950500-53950522 CCTGACATGCTGGCCCTGGTGGG + Exonic
1117375563 14:55115520-55115542 CCAGGCAGGCAGCATCTGGGAGG + Intergenic
1118448892 14:65879321-65879343 CTAGAAATGCAGCACCTTGGTGG - Intergenic
1119223310 14:72926281-72926303 CCAGACAGGCCAGGCCTGGGAGG + Intergenic
1120611355 14:86645970-86645992 TCAGGCATCCAGGACCTGTGGGG - Intergenic
1121898360 14:97670125-97670147 CTGGACATGCAGGATCTTGGTGG + Intergenic
1123119523 14:105910257-105910279 CCAGAAATGCAGGACATGGCAGG + Intergenic
1123121731 14:105919850-105919872 CCAGCAATGCAGGACATGGCAGG + Intronic
1202924285 14_KI270724v1_random:9402-9424 CTAGACATGCTGGACCTGTGAGG + Intergenic
1123404436 15:20011501-20011523 CCAGCAATGCAGGACATGGCAGG + Intergenic
1123513769 15:21018148-21018170 CCAGCAATGCAGGACATGGCAGG + Intergenic
1123994664 15:25710166-25710188 CAAGACACACAGGACTTGGGTGG - Intronic
1124112876 15:26808308-26808330 CCACACAGCCAGGGCCTGGGAGG + Intronic
1125469617 15:39990134-39990156 CCAGACAGCCTGGACCAGGGTGG + Intronic
1125598547 15:40902922-40902944 CGAGACCTGCAGGAGCTGCGGGG + Exonic
1125714967 15:41814438-41814460 CCAAACCTGCAGGTCCAGGGAGG + Intronic
1126161352 15:45616565-45616587 CCAGAAATGCAGGCCCAGGAAGG - Intronic
1126802754 15:52315257-52315279 CCACACTTGCAGAAACTGGGAGG + Intronic
1127104129 15:55595197-55595219 CCAGCACTGCAGGACCTGGAAGG + Intergenic
1127929810 15:63586603-63586625 CCAGAGATGTAGGACTTGGGAGG + Intronic
1128218311 15:65949678-65949700 CCAGACACGCAGGACCCATGCGG + Intronic
1128914777 15:71549850-71549872 TCAGATAAGCAGGACCTGGCAGG + Intronic
1129760677 15:78127649-78127671 CCAGGCATGTAGGAGATGGGAGG - Intronic
1129968578 15:79757999-79758021 TCAGGCAGGAAGGACCTGGGAGG + Intergenic
1130109374 15:80952148-80952170 CCAGCCAAACAGGGCCTGGGAGG - Intronic
1130648396 15:85748208-85748230 ACAGCCAGGCAGGCCCTGGGAGG + Intronic
1131469469 15:92683717-92683739 CTAGACCTGTAGGACATGGGAGG - Intronic
1132731536 16:1364844-1364866 CCACACGAGCAGGACCAGGGTGG + Intronic
1133781326 16:8941429-8941451 CCAGACAGGAAGGACCTGAGGGG + Intronic
1134183198 16:12063843-12063865 CTAGAAATGCAGGACTTCGGTGG - Intronic
1135666215 16:24337725-24337747 CCAAACATGCAGGAATGGGGAGG - Intronic
1136910755 16:34142491-34142513 CCAGGCATGCAGGGCGTGTGGGG - Intergenic
1139324724 16:66143651-66143673 CCAGACAGCTTGGACCTGGGAGG - Intergenic
1141198985 16:81882844-81882866 CCAGACCTGGAGGACCAGAGGGG - Intronic
1141648021 16:85377824-85377846 CCACATGTGCAGGAGCTGGGGGG + Intergenic
1141921665 16:87139642-87139664 CCAGACATCCACGAGCTTGGGGG + Intronic
1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG + Intergenic
1142354388 16:89595496-89595518 ACCGACATGCAGGTCCTGGACGG + Exonic
1145960316 17:28883338-28883360 TCAGACCTGGAGGCCCTGGGGGG + Intronic
1146560240 17:33862647-33862669 CCAGTCATGGAAGACCTGGTTGG - Intronic
1146948328 17:36889065-36889087 CCAGCCAAGGAGGAGCTGGGGGG + Intergenic
1147889967 17:43710280-43710302 GCTGACAGGCAGGCCCTGGGCGG + Intergenic
1148405819 17:47414421-47414443 ATAGGCATGCAGAACCTGGGAGG + Intronic
1148577452 17:48722054-48722076 CGGGACCTGCAGGACCTAGGCGG - Intronic
1148820488 17:50356916-50356938 CCAGGCATGCAGGTGCTGTGGGG + Intronic
1149651722 17:58280086-58280108 GCAGACATGCAGGACCATGCAGG + Intronic
1151321077 17:73352648-73352670 ACAGAGATGGAGGCCCTGGGAGG + Intronic
1152095176 17:78268363-78268385 GGAGCCCTGCAGGACCTGGGAGG + Intergenic
1152238325 17:79149745-79149767 ACGGACCTGCAGGTCCTGGGAGG + Intronic
1153062950 18:1012971-1012993 CCAGCCAGGCAGAACCTGTGTGG - Intergenic
1155289371 18:24325302-24325324 CCAGGCCTGCAGGGCCTGGTTGG - Intronic
1156459402 18:37313199-37313221 AAGGACATGCTGGACCTGGGAGG + Intronic
1157144055 18:45143062-45143084 CCAGGCATGCAGCACGTAGGAGG + Intergenic
1160341135 18:78089714-78089736 CCAGATCTGCAGCACCAGGGTGG + Intergenic
1160443918 18:78913010-78913032 GCACACATGCAGGCCCTGGAAGG - Intergenic
1161296104 19:3520959-3520981 CCAGACACAAAAGACCTGGGAGG - Intronic
1161354851 19:3813345-3813367 CCAGACCTGCCAGGCCTGGGAGG - Intronic
1161493713 19:4576277-4576299 CCAGTCATGCAGGGCCTCGTGGG - Intergenic
1161902839 19:7132303-7132325 GCAGAGATGCAGCTCCTGGGAGG + Exonic
1162336180 19:10061940-10061962 CTAGAGAAGCAGGAGCTGGGAGG + Intergenic
1162439841 19:10686218-10686240 CCAGACCTCCAGGCCCAGGGTGG - Intronic
1162790067 19:13058124-13058146 CCAGAGAAGCAGGAGCTGGGAGG - Intronic
1163626621 19:18393790-18393812 ACAGACATGGAGGCTCTGGGAGG - Intronic
1167198781 19:48049557-48049579 CCACGGCTGCAGGACCTGGGCGG + Intronic
1167745877 19:51351620-51351642 CCAAAAAGGCAGGGCCTGGGTGG - Intronic
1168274777 19:55271610-55271632 CCAGCCATGCAGAGGCTGGGAGG - Intronic
926122847 2:10254239-10254261 CCAGGCCAGCAGAACCTGGGAGG - Intergenic
927175157 2:20400588-20400610 CCAGGCATGGAGGTGCTGGGAGG + Intergenic
927445740 2:23159995-23160017 ACATACATTCAGGAGCTGGGAGG - Intergenic
930015607 2:46968451-46968473 CCAAGCCTGCAGCACCTGGGTGG + Intronic
931015966 2:57981308-57981330 CCAGACATGTAATTCCTGGGTGG + Intronic
931163379 2:59718569-59718591 CCAGACAGGCAGGACTTGCTGGG + Intergenic
932042940 2:68319384-68319406 CCAGACATGGGGGACCTGCCGGG - Exonic
932692659 2:73926498-73926520 CCAGACAACAAGCACCTGGGGGG + Intergenic
933893645 2:86791648-86791670 CCAGCAATGCAGGCCATGGGAGG - Intronic
933902446 2:86859734-86859756 GCAGAGATGCAGGAGTTGGGAGG + Intronic
934131736 2:88955154-88955176 CCAGTCATTCAGGACAAGGGAGG - Intergenic
934133240 2:88969791-88969813 CCAGTCATTCAGGACAAGGGAGG - Intergenic
934136006 2:88996976-88996998 CCAGTCATTCAGCACCAGGGAGG - Intergenic
934220317 2:90076321-90076343 CCAGTCATTCAGTACCAGGGAGG + Intergenic
934659814 2:96137481-96137503 TCAGAAATGCAGAGCCTGGGAGG - Intronic
934715683 2:96542003-96542025 CCAGGCAGGCAGGACCTGCATGG - Intronic
935270436 2:101429837-101429859 CCAGGTAAGGAGGACCTGGGAGG + Intronic
936069036 2:109353272-109353294 GCAGCCATGCAGGCCCAGGGAGG - Intronic
938138050 2:128775185-128775207 CCAGCCTTGCAGGACCAGCGAGG - Intergenic
940327904 2:152444329-152444351 CCACCCATGCAGGGTCTGGGCGG - Intronic
941278193 2:163517186-163517208 CCAGCAATGGAGGACCTAGGAGG + Intergenic
943771698 2:191724328-191724350 ACAGACCTACAGGGCCTGGGAGG + Intergenic
945058409 2:205887938-205887960 GAAGGCATGCAGGGCCTGGGAGG + Intergenic
946450216 2:219773298-219773320 CCTGAAATGAAGGAGCTGGGAGG + Intergenic
947456102 2:230255313-230255335 GCAGACCAGGAGGACCTGGGTGG + Intronic
948631565 2:239306322-239306344 ACTGACTTGCTGGACCTGGGTGG - Intronic
948869831 2:240792329-240792351 CCAGCCCAGCAGGCCCTGGGAGG - Intronic
948893427 2:240917627-240917649 CCAGGCAAGGAGGACTTGGGTGG + Intergenic
1169360642 20:4945974-4945996 CCAGAATTGCAGCACCAGGGTGG + Intronic
1170032976 20:11961487-11961509 CTAGACATGCAGGACCTGAATGG - Intergenic
1171182603 20:23101925-23101947 CCAGAGCTGCAGGCCCTGGGAGG + Intergenic
1172870538 20:38132786-38132808 CCAAACATCGAGGACCTGGGAGG - Intronic
1173707661 20:45124342-45124364 GCAGACATGGTGGAGCTGGGTGG - Intronic
1175723645 20:61302619-61302641 CGGGCCATGCAGGACATGGGAGG - Intronic
1176248915 20:64110807-64110829 CCAGCCAGGCAGGCCCTGGTAGG + Intergenic
1176270111 20:64231923-64231945 CCAGTCATGCAGGGGCTGTGAGG + Intronic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1178350918 21:31872895-31872917 CCAGACAGGGAGAACCTGCGCGG - Intergenic
1179013475 21:37574563-37574585 CTAGACATGCAGGGTCTGTGAGG - Intergenic
1179317851 21:40260889-40260911 CCCGACATCCAGGAGCTGGCTGG + Intronic
1180010839 21:45050103-45050125 CAGGACAAGCAGGGCCTGGGTGG - Intergenic
1180315768 22:11276737-11276759 CCAGGCGTGCAGGGCCTGTGGGG - Intergenic
1181046735 22:20218220-20218242 CCAGACATGCAACACTGGGGGGG + Intergenic
1181064017 22:20297168-20297190 CCCAACATACAGGGCCTGGGTGG + Intergenic
1181111682 22:20606262-20606284 CCACACCTCCAGGACCTGTGGGG + Intergenic
1181340914 22:22179184-22179206 CCAGAGATACAGGAAGTGGGGGG - Intergenic
1181865295 22:25850053-25850075 ACAGAGATGGGGGACCTGGGAGG - Intronic
1182543062 22:31055806-31055828 CCAGACAGGCAGGCCCTGTGAGG + Intergenic
1183377218 22:37472365-37472387 CCAAACATGGGGGAGCTGGGAGG - Intronic
1183498573 22:38164482-38164504 CCAGGCATGCAGGACCTGCTGGG + Intronic
1183539883 22:38423761-38423783 CCAGCCCTGCAGGCCCTGGGTGG - Intergenic
1183934260 22:41253161-41253183 CCAGAGATGCTGGCCCTGGATGG + Intronic
1184730713 22:46369635-46369657 CCAAACATGCATGAGCTGGAAGG - Intronic
1185095691 22:48804859-48804881 CCAGACAATCAGGGCCTGGCTGG + Intronic
950497555 3:13343120-13343142 GCTGACCTGCAGGAACTGGGAGG - Intronic
950720236 3:14877329-14877351 CCAGACGTGCAGATTCTGGGTGG - Intronic
953248875 3:41224688-41224710 CCACTCATACAGGACTTGGGAGG - Exonic
953415168 3:42711639-42711661 GCAGAGATGGAGGAACTGGGAGG - Intronic
953586925 3:44210055-44210077 CCAGGGTTGCAGGACCTGGGAGG - Intergenic
953709726 3:45259966-45259988 CCAGGCATGGAGGGCCGGGGAGG - Intergenic
954554516 3:51507383-51507405 CCAGACCTGCAGACCCTGAGAGG - Intergenic
954611859 3:51948494-51948516 CCAGCCTTGCAGGACCCCGGGGG - Exonic
957117695 3:76047530-76047552 CCAGAGATCCAGATCCTGGGTGG - Intronic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
960763550 3:121098942-121098964 CCAGAATTGCAGGATCTGTGAGG - Intronic
961451225 3:127003205-127003227 CCAGACATGCATGAGCAGAGAGG - Intronic
961461932 3:127056219-127056241 CCAGACCTGCAGCCCCTGTGCGG - Intergenic
964523219 3:157589198-157589220 CCAGATATGGAGCACATGGGAGG + Intronic
965506924 3:169526342-169526364 ACAGACATGAAGGAGGTGGGAGG + Intronic
967811385 3:193763999-193764021 CAAGTCATGTAGGACCTGGTGGG - Intergenic
968077406 3:195824111-195824133 GCAGAAAAGCAGGGCCTGGGTGG + Intergenic
968605326 4:1532595-1532617 CCTGGCAGGCTGGACCTGGGTGG - Intergenic
971089566 4:23325096-23325118 CTAAAAATTCAGGACCTGGGAGG - Intergenic
971257699 4:25029895-25029917 CAAGGCATGCAGGCTCTGGGAGG - Intronic
972765530 4:42150557-42150579 ACTGACATGCAGGATTTGGGGGG + Intronic
978980945 4:114944841-114944863 CCAAAAATGCAGCACCGGGGTGG - Intronic
982108644 4:152033265-152033287 CGAGACATCCAGGATGTGGGGGG + Intergenic
982609377 4:157554131-157554153 CAGGAAATACAGGACCTGGGGGG - Intergenic
983671961 4:170247709-170247731 CCAGACATTCAGCAACTGGAGGG - Intergenic
983752418 4:171292087-171292109 ACAGACATGCAGGAATTTGGGGG + Intergenic
987113683 5:14710639-14710661 CCACACATGCAGGAGGCGGGTGG - Exonic
991949683 5:71935282-71935304 CCAGAGACTCAGGACCTGTGGGG - Intergenic
993712061 5:91234986-91235008 CCAGTCATTCAGGACCTTGCAGG + Intergenic
997163130 5:131630442-131630464 CCAAACCTGCAGTATCTGGGAGG + Intronic
997400326 5:133597096-133597118 CTAGACATGGAGGATGTGGGAGG - Intronic
999628062 5:153540986-153541008 CAAAACCTGCAGGACCCGGGAGG + Intronic
1001705066 5:173735593-173735615 CAAGACCTGCAGGACATGGATGG + Intergenic
1002911971 6:1497533-1497555 CCAGCCAGGCAGGGCCAGGGTGG + Intergenic
1004183395 6:13400167-13400189 TAAGACATGCAGGACCGGGCAGG + Intronic
1006374660 6:33665254-33665276 CATGAAATGCAGGCCCTGGGAGG - Intronic
1007256360 6:40532004-40532026 CCATATATGCAGGAACTGTGCGG - Intronic
1009994081 6:70879911-70879933 CCAACCATGCAGGGCCTGGGAGG + Intronic
1013349071 6:109289980-109290002 CCAGACATCCAGGAACGGGTTGG + Intergenic
1018733856 6:166672989-166673011 CCTGACCTGCAGGCTCTGGGTGG + Intronic
1019556461 7:1633914-1633936 CCTGACATGCAGCCCCTGGTGGG + Intergenic
1020334405 7:7051619-7051641 CCAGACAAGCAGGGCATGAGAGG - Intergenic
1021183472 7:17535245-17535267 CAACACCTGCAGTACCTGGGTGG - Intergenic
1021566650 7:22023158-22023180 CCAGAAATGCAGAATCTGGCCGG - Intergenic
1022574287 7:31482632-31482654 CCAGAGATGCAAGACTTGGCAGG + Intergenic
1023136029 7:37052873-37052895 TCAGACAAACACGACCTGGGGGG - Intronic
1025871410 7:65437830-65437852 CTAGACATGCAGCACTGGGGAGG + Intergenic
1026883275 7:73920736-73920758 CCAGACATGAGGGCCCTGGAAGG + Intergenic
1027627630 7:80564743-80564765 CCAGACCTGGAGGACCTGCCTGG + Intronic
1029260814 7:99301593-99301615 CTGGACCTGCAGGTCCTGGGGGG - Intergenic
1029388618 7:100259835-100259857 TCAGACGGGCAGGACCTGGGTGG + Intronic
1030396659 7:108994931-108994953 GGAGACAAGCAGGAACTGGGAGG + Intergenic
1030682325 7:112446985-112447007 CCCTACATGGAGGATCTGGGAGG + Intronic
1032575074 7:133044894-133044916 TCAGAGCTGCAGGACTTGGGAGG - Intronic
1032803777 7:135336793-135336815 CCAGACATGCAAGGCCTTGTTGG + Intergenic
1034275304 7:149821389-149821411 CCCGACGTGGAGGACCTGGGTGG - Intergenic
1035628410 8:1090522-1090544 CCAGAAATTCAGGGCCTGAGTGG + Intergenic
1035663801 8:1365502-1365524 CCTGCCATCCTGGACCTGGGAGG - Intergenic
1039462074 8:37753442-37753464 CCAGAAATGCAGCATCTGAGGGG - Exonic
1039464598 8:37775470-37775492 CCAGACTTCCAGGTACTGGGGGG + Exonic
1040081548 8:43291288-43291310 CCAGACATGCGGGACTCAGGTGG - Intergenic
1041561795 8:59226495-59226517 CCAGGCCTGCAGGACCTGCCTGG - Intergenic
1044088869 8:87974575-87974597 CCTGACATGATGGACCTGAGGGG + Intergenic
1047370786 8:124254107-124254129 CCAGCCATGCAGGGTCTTGGAGG + Intergenic
1047741458 8:127810121-127810143 TCAGGCATGCTGGGCCTGGGGGG + Intergenic
1048229321 8:132621374-132621396 CCAGTGGTGCATGACCTGGGAGG + Intronic
1048875704 8:138835587-138835609 CCAGCCCTGCAGGTCCTGAGGGG - Intronic
1049027440 8:140004719-140004741 TTAGACATGCTGGACCTTGGCGG - Intronic
1049140279 8:140948375-140948397 GGAGACATGCTGGAACTGGGGGG + Intronic
1049251085 8:141589315-141589337 CCAGACTTGCAGAAGCTGGTGGG + Intergenic
1053470997 9:38346150-38346172 CCACACAAGCAGGCCCTTGGAGG - Intergenic
1053485471 9:38451339-38451361 CCAGACAAGCAAAAACTGGGGGG - Intergenic
1056578845 9:87876011-87876033 CCACCCAGGCAGGACCTGGACGG + Intergenic
1056797876 9:89671310-89671332 CCACACAGGCAGGTGCTGGGAGG - Intergenic
1056803968 9:89713619-89713641 CCTGACTTGCAGAAACTGGGTGG - Intergenic
1062103489 9:134740276-134740298 CCAGCCATGCCGGTCCTGGCTGG - Intronic
1062635029 9:137486147-137486169 CCAGACACGCAGGTCCTGATTGG + Intronic
1185505617 X:630720-630742 CCAGACAGGCAGCGCATGGGGGG + Exonic
1187173867 X:16877746-16877768 CCAGAGATTCAGGAGCGGGGAGG + Intergenic
1188099942 X:26071363-26071385 CCAGACCTCCAGGAGCTGGCAGG + Intergenic
1190872957 X:54440203-54440225 CCAGACCTGAAGGACGTGTGGGG - Intergenic
1190938183 X:55015227-55015249 CTAGATAGGCAGGAGCTGGGTGG + Intronic
1191155231 X:57266419-57266441 CCAGGCATGGAGGACCTGCCTGG - Intergenic
1192245589 X:69369232-69369254 GCAGAGAGGCAGGAACTGGGGGG - Intergenic
1194665649 X:96674764-96674786 CCAGAGAGGGAGGACCTGGAAGG - Intergenic
1194816370 X:98446769-98446791 CCGGAAATGCAGGACATGGGTGG - Intergenic
1200768599 Y:7102952-7102974 CCAGAAATGCAGGACCAGCCTGG + Intergenic