ID: 1073291040

View in Genome Browser
Species Human (GRCh38)
Location 10:102413453-102413475
Sequence CAGGCTAAAGACTCTGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073291036_1073291040 17 Left 1073291036 10:102413413-102413435 CCTTCAGGCTGGGTGAGGGTAAG 0: 1
1: 0
2: 0
3: 17
4: 252
Right 1073291040 10:102413453-102413475 CAGGCTAAAGACTCTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073291040 Original CRISPR CAGGCTAAAGACTCTGCCAA GGG Intronic
No off target data available for this crispr