ID: 1073293699

View in Genome Browser
Species Human (GRCh38)
Location 10:102425652-102425674
Sequence CCCTTTGTGCAGAGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 293}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073293699_1073293709 -5 Left 1073293699 10:102425652-102425674 CCACCCACCCTCTGCACAAAGGG 0: 1
1: 0
2: 2
3: 39
4: 293
Right 1073293709 10:102425670-102425692 AAGGGGCTTTTCTGGCTCTGGGG No data
1073293699_1073293715 23 Left 1073293699 10:102425652-102425674 CCACCCACCCTCTGCACAAAGGG 0: 1
1: 0
2: 2
3: 39
4: 293
Right 1073293715 10:102425698-102425720 ATAGAAGGGGAAGCCTTTCATGG No data
1073293699_1073293712 10 Left 1073293699 10:102425652-102425674 CCACCCACCCTCTGCACAAAGGG 0: 1
1: 0
2: 2
3: 39
4: 293
Right 1073293712 10:102425685-102425707 CTCTGGGGCCCAGATAGAAGGGG No data
1073293699_1073293710 8 Left 1073293699 10:102425652-102425674 CCACCCACCCTCTGCACAAAGGG 0: 1
1: 0
2: 2
3: 39
4: 293
Right 1073293710 10:102425683-102425705 GGCTCTGGGGCCCAGATAGAAGG No data
1073293699_1073293708 -6 Left 1073293699 10:102425652-102425674 CCACCCACCCTCTGCACAAAGGG 0: 1
1: 0
2: 2
3: 39
4: 293
Right 1073293708 10:102425669-102425691 AAAGGGGCTTTTCTGGCTCTGGG No data
1073293699_1073293707 -7 Left 1073293699 10:102425652-102425674 CCACCCACCCTCTGCACAAAGGG 0: 1
1: 0
2: 2
3: 39
4: 293
Right 1073293707 10:102425668-102425690 CAAAGGGGCTTTTCTGGCTCTGG No data
1073293699_1073293711 9 Left 1073293699 10:102425652-102425674 CCACCCACCCTCTGCACAAAGGG 0: 1
1: 0
2: 2
3: 39
4: 293
Right 1073293711 10:102425684-102425706 GCTCTGGGGCCCAGATAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073293699 Original CRISPR CCCTTTGTGCAGAGGGTGGG TGG (reversed) Intronic
900402687 1:2479053-2479075 GGCTCTGTGCAGGGGGTGGGTGG + Intronic
900479479 1:2891205-2891227 CTCTTTGTGGAGGGGGTGGGGGG - Intergenic
900608226 1:3533272-3533294 CCATTTCTGCAGAGTGTTGGGGG - Intronic
900992451 1:6104273-6104295 CCCTTGGTGCTGCGGCTGGGAGG + Exonic
901805893 1:11738313-11738335 CCCTTTGTGCAAAGGGCCTGGGG - Intronic
901870951 1:12138977-12138999 CTGCTTCTGCAGAGGGTGGGTGG - Intronic
902610705 1:17595645-17595667 CCCTCTGTGCACAGGATGGGCGG + Intronic
903409275 1:23127378-23127400 GGCTTAGTGCAGAGGGTGGAAGG - Intronic
903967367 1:27099160-27099182 CCCATTGTGGAGGCGGTGGGGGG - Exonic
905869434 1:41394707-41394729 CCCTCTGGGGAGAGGGTGGTGGG + Intergenic
906449869 1:45936283-45936305 ACCTTTGGGCAGAGGCTGTGGGG + Intronic
908357302 1:63335479-63335501 CCCTCAGTGGAGGGGGTGGGGGG - Intergenic
909319510 1:74265516-74265538 CCCTTTATGAAGAGTGTGGCAGG - Intronic
909342218 1:74544962-74544984 ACATTTGTTGAGAGGGTGGGGGG + Intergenic
909593831 1:77381981-77382003 CTCCCTGTGCAGAGGGTGGGTGG - Intronic
912958205 1:114171197-114171219 CCCCTTGTGTTGAGGGAGGGAGG - Intergenic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
915508347 1:156371606-156371628 CCCCTTCTGCCTAGGGTGGGTGG - Intronic
915523770 1:156464029-156464051 CCCATTCTCCAGAGGGAGGGAGG - Exonic
915540939 1:156565766-156565788 CCCATTATGCAGGGGGTGGGAGG - Intronic
915589562 1:156862799-156862821 CCCTCTGGGCAGGGGCTGGGGGG + Intronic
915807751 1:158872432-158872454 CCTGTTGTGCAGTGGGGGGGAGG + Intergenic
917726795 1:177835608-177835630 TCATTTGTGCAGAGGGAGGTAGG + Intergenic
919621751 1:199871439-199871461 CCCTGTGTCCAGAGTGTGTGAGG - Intergenic
920174006 1:204088947-204088969 CCAGTGGTCCAGAGGGTGGGAGG + Intronic
920369652 1:205470211-205470233 CCCATGTTGGAGAGGGTGGGAGG + Intergenic
920416772 1:205804262-205804284 CCCTGTGTGAATGGGGTGGGAGG + Intronic
921075701 1:211698731-211698753 TCTTTTTTGCAGAGGGAGGGAGG + Intergenic
921284832 1:213599972-213599994 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
923086032 1:230704134-230704156 CCAAGTGTGCACAGGGTGGGAGG - Intronic
924314023 1:242776939-242776961 ACCTGAGAGCAGAGGGTGGGAGG + Intergenic
1064317340 10:14270495-14270517 GGCTCTCTGCAGAGGGTGGGAGG - Intronic
1064935920 10:20679037-20679059 AGCTTTGTCCAGAGGATGGGAGG - Intergenic
1067311943 10:45121821-45121843 CCCTTTGGCCTGAGGGTAGGTGG - Intergenic
1067655805 10:48190349-48190371 CCCTTTGGTCAAAGGATGGGAGG - Intronic
1067683071 10:48452229-48452251 GCCTTTGTGGTGAGGGTGGCAGG - Intronic
1068423081 10:56821654-56821676 TCCCCTGTGCAGAGGGAGGGGGG - Intergenic
1068936555 10:62640598-62640620 CCCATTTTGCACAGTGTGGGTGG + Intronic
1069089308 10:64180102-64180124 CCCTGGTTGCAGACGGTGGGTGG + Intergenic
1069435492 10:68378346-68378368 CCCTTTGTGCACAAGGTTTGAGG + Intronic
1073204577 10:101762159-101762181 AGCTTTGTGCTGAGTGTGGGGGG - Intergenic
1073293699 10:102425652-102425674 CCCTTTGTGCAGAGGGTGGGTGG - Intronic
1074188593 10:111116886-111116908 CTCGATGTGCAGAGGGAGGGAGG - Intergenic
1076256196 10:129026481-129026503 CCCTTTGTGCCGAGTGCCGGTGG - Intergenic
1076540314 10:131210332-131210354 CCCTGGGGGCAGAGGGTTGGGGG - Intronic
1077321316 11:1943556-1943578 TCATTCGTACAGAGGGTGGGGGG - Intergenic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1078081347 11:8206850-8206872 ACATTTGTTCAGAGGGAGGGTGG - Intergenic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1079241186 11:18723261-18723283 ACCTTAGTGCAGGGGGTGTGAGG - Intronic
1079350227 11:19685847-19685869 CTCTTGGTGCAGAGCGTGGGAGG - Intronic
1079561018 11:21819692-21819714 CCTTTTGTGCAGGTGGTAGGGGG + Intergenic
1080604456 11:33853200-33853222 CACTTTGGGCAGAGGGTTGCAGG + Intergenic
1081749739 11:45501519-45501541 CCCTTTGTCCAGACAGAGGGAGG + Intergenic
1085313672 11:75530858-75530880 GCCTCTGTGCTGAGGGTGGAGGG + Intergenic
1085397391 11:76213484-76213506 ACCTTGGTGGAGATGGTGGGGGG + Intergenic
1085477424 11:76796998-76797020 CGCAATGGGCAGAGGGTGGGTGG + Exonic
1085720677 11:78909888-78909910 GCCTTTATCCAGAGGGTGGGGGG + Intronic
1088364896 11:109030461-109030483 CCTTTTGTGGAGTGGGGGGGAGG - Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089589432 11:119531151-119531173 CCCTGGGTGCTGAGGCTGGGAGG - Intergenic
1089612003 11:119674498-119674520 CCCGTTTTACAGATGGTGGGGGG + Intronic
1090880389 11:130827585-130827607 CCCTTTGGGAAGAGTGTGTGGGG + Intergenic
1091444348 12:535041-535063 ACCTCTCTTCAGAGGGTGGGTGG - Intronic
1092227813 12:6759899-6759921 GCCTTTGAGCAGAGGCAGGGCGG + Intronic
1092926419 12:13276300-13276322 CCTTTTGGGAAGTGGGTGGGTGG + Intergenic
1096252597 12:50042547-50042569 CCATTGGAGCAGAGGGTTGGAGG + Intergenic
1096778719 12:53979719-53979741 TGCTTTGTGCAGTGGGTTGGAGG - Intergenic
1101132032 12:101698843-101698865 CCCTTTGGGCTGAGTGTGGAGGG + Intronic
1101735453 12:107459810-107459832 CCCTGTGTGCTGTGGGTGGCAGG + Intronic
1102461719 12:113104076-113104098 CACATTCTGCAGCGGGTGGGAGG + Exonic
1103044198 12:117721812-117721834 CCCTTTAAGCAGAGGGAGGTGGG + Intronic
1103931470 12:124453152-124453174 CCCTCTCTGCAGAGGATGAGGGG - Intronic
1104761822 12:131301242-131301264 ATCTTTGCCCAGAGGGTGGGGGG - Intergenic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1106787594 13:33122577-33122599 CCCTTTCTCAAGAGGGTGGCTGG - Intronic
1108807806 13:54181413-54181435 ACTTGTGGGCAGAGGGTGGGAGG - Intergenic
1109915774 13:68983552-68983574 CCCATTGTTCAGTGAGTGGGAGG + Intergenic
1112537568 13:100275040-100275062 CCCTTGGGGGAGGGGGTGGGGGG + Intronic
1113113397 13:106848645-106848667 GCCTTTCTGCAGAGGGTGGGGGG - Intergenic
1113786960 13:113006961-113006983 CCCTTGGGGGAGAGGGTGGCAGG + Intronic
1114572473 14:23682226-23682248 CCCTTTGGTCAAAGCGTGGGAGG - Intergenic
1115176776 14:30571617-30571639 TGCTTTGGGCGGAGGGTGGGGGG - Intronic
1118427921 14:65687700-65687722 CACTTGGTGCAGGGGGTAGGGGG - Intronic
1119481958 14:74963500-74963522 CACAGTGTGCAGAGGGTGAGGGG - Intergenic
1120671720 14:87369914-87369936 CCATTTCTGCTAAGGGTGGGTGG + Intergenic
1121163423 14:91768014-91768036 CCCTTTTTGTAGGGGGTTGGTGG - Intronic
1122060453 14:99133627-99133649 CGCTGAGTGCAGAGGGTGGGTGG - Intergenic
1122141611 14:99666387-99666409 CTGTGTGTGCAGAGGGTTGGGGG + Intronic
1122270533 14:100566917-100566939 CCCTTAGTGCCGTGGGTGAGTGG - Intronic
1122324623 14:100874958-100874980 CCCTTTGTGCCCAGGGTGGAGGG + Intergenic
1122784071 14:104155852-104155874 CCCTGTGGGAAGAGGGTGGAGGG + Intronic
1122789669 14:104178957-104178979 CCCCTTGGGCAGTGGGTGGGTGG + Intronic
1123981839 15:25612057-25612079 CCACTGGAGCAGAGGGTGGGAGG - Intergenic
1125679321 15:41520949-41520971 CCCTCGGTGCAGAGCCTGGGAGG + Exonic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1126425561 15:48523743-48523765 CACTTTGTACAGAGGGTAAGGGG + Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1129296819 15:74604335-74604357 CCCTGTGGGCAGAGGGGAGGTGG + Intronic
1129327227 15:74807161-74807183 TCCTTAGAGCAGGGGGTGGGTGG + Intergenic
1130244100 15:82227264-82227286 ACCTTTGGGGTGAGGGTGGGAGG + Intronic
1130605574 15:85313471-85313493 CCCTTTGGGCAGAGCATGGGTGG - Intergenic
1130915633 15:88302475-88302497 CCAGTTGGGCAGAGGGTGAGTGG - Intergenic
1131697367 15:94892500-94892522 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
1132363015 15:101233626-101233648 CCCTATGTGCTGGGGTTGGGGGG + Intronic
1133516989 16:6519075-6519097 CACTTTGTGCATACGATGGGTGG - Intronic
1136054845 16:27680686-27680708 CTTTTTTTGCAGAGGGAGGGTGG + Intronic
1136791069 16:32968521-32968543 CCCTTTGTGGGGGAGGTGGGGGG - Intergenic
1137789386 16:51162171-51162193 CCCTTAGTGCTCAGGGTGGCTGG + Intergenic
1138724236 16:59118502-59118524 CCTTGTCTGCAGTGGGTGGGTGG + Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139328700 16:66171147-66171169 ACCCTTGAGCAGAGGCTGGGCGG + Intergenic
1139475468 16:67200536-67200558 CCCTTTGTGAGGAAGGTGGGTGG + Exonic
1141087744 16:81108900-81108922 CCCTTTCTGCCCAGGGTAGGGGG + Intergenic
1141336149 16:83157329-83157351 CCCTTTGGGCAGGGAATGGGTGG + Intronic
1142201214 16:88761982-88762004 CCCTTTCTGGAGAGGCTGCGGGG - Intronic
1142225972 16:88877775-88877797 CCCTGTGGGCAGAGGGGGTGGGG + Intronic
1142426040 16:90002858-90002880 CCCTTCTGGCAGAGGGAGGGAGG - Intergenic
1142759698 17:2035370-2035392 CCCTTGGTGCCCAGGATGGGGGG - Intronic
1142899737 17:3004538-3004560 ACCTCTGTGCAGAGGGAAGGCGG + Intronic
1143032619 17:3976372-3976394 TCCTGTGTGCAGGGGCTGGGGGG + Intergenic
1143089355 17:4439825-4439847 CCCCTGGCACAGAGGGTGGGTGG + Intronic
1143907962 17:10224963-10224985 GCAGATGTGCAGAGGGTGGGCGG - Intergenic
1144440992 17:15281509-15281531 GCTTTGGTGCAGAGGGTGGGGGG - Intergenic
1145795448 17:27652975-27652997 CCCATTTTGCAGAGGGAAGGGGG - Intergenic
1146122519 17:30208092-30208114 CTCTTTCTACATAGGGTGGGAGG + Intronic
1146255227 17:31388483-31388505 CCCTTTGCTTAGTGGGTGGGAGG - Intergenic
1147153341 17:38531097-38531119 CCCTTTGTGGGGGAGGTGGGGGG - Exonic
1147423017 17:40331921-40331943 CCCTTTGTGGGGAGGATGAGAGG + Intronic
1147449749 17:40496573-40496595 GCCTTTGTACGGAGGGTGGGAGG - Intronic
1147538967 17:41340682-41340704 CCCTGAGAGCAGAGGGTGTGTGG - Intergenic
1147781743 17:42947898-42947920 CCCTTGGTGCAAAGGGTAAGGGG - Intergenic
1148564835 17:48626676-48626698 CCCTTCCTGCAGCGGGAGGGGGG - Intronic
1151279710 17:73064411-73064433 CATTTTGTGCAAATGGTGGGAGG - Intronic
1151508690 17:74545104-74545126 CCCTCTGTGCAGAGGTGGGAAGG + Intronic
1152205000 17:78969928-78969950 ACCTGTGGGGAGAGGGTGGGTGG + Intergenic
1152877426 17:82794937-82794959 CCCTTACTGCAGATGGTGGCGGG + Intronic
1157208033 18:45717218-45717240 CTCTTTGAGGAGATGGTGGGGGG - Intergenic
1157295303 18:46437880-46437902 ACCTGTGGGCAGAGGGTGGGTGG + Intronic
1158747520 18:60218454-60218476 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
1159301878 18:66583487-66583509 ACCTGAGGGCAGAGGGTGGGAGG - Intronic
1159377758 18:67615667-67615689 CACTTTTTTCACAGGGTGGGAGG - Intergenic
1159883794 18:73885120-73885142 CCCATTGTGCAGAAGCTGGCTGG + Intergenic
1160217090 18:76941493-76941515 CCACCTGTGCAGTGGGTGGGAGG - Intronic
1160257596 18:77260319-77260341 CCCATTATTCATAGGGTGGGAGG + Intronic
1160421877 18:78753569-78753591 TCCATTCTGCTGAGGGTGGGCGG - Intergenic
1160506035 18:79427376-79427398 GCCTCTGTGCAGTGGGTTGGGGG + Intronic
1160506048 18:79427413-79427435 GCCTCTGTGCGGTGGGTGGGGGG + Intronic
1160506081 18:79427520-79427542 GCCTCTGTGCAGTGGGTGGGGGG + Intronic
1160506091 18:79427556-79427578 GCCTCTGTGCAGTGGGTCGGGGG + Intronic
1160506143 18:79427733-79427755 GCCTCTGTGCAGTGGGTGGGGGG + Intronic
1160506162 18:79427801-79427823 CCCTCTGTGCAGGGGTCGGGGGG + Intronic
1160506202 18:79427949-79427971 GCCTCTGTGCAGTGGGTGGCGGG + Intronic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160535368 18:79588769-79588791 CCCTCCGTGCAGGGGCTGGGAGG - Intergenic
1160600202 18:80006721-80006743 TCCCTTGTGCAGAGTGAGGGGGG + Intronic
1160875580 19:1294987-1295009 CCCTGTGTGCAAAGGGCCGGCGG - Intronic
1160986079 19:1839566-1839588 ACCTGTGTGCAGATGCTGGGGGG + Intronic
1161614260 19:5261170-5261192 CCCTCTGGGCTGAGGGAGGGAGG + Intronic
1162032348 19:7922940-7922962 CCCGTTGTACAGGGGTTGGGTGG + Exonic
1162842022 19:13363641-13363663 CACTGGGTGGAGAGGGTGGGTGG + Intronic
1163684050 19:18700617-18700639 ACCTGGGTGCAGAGGGTGGGTGG + Intronic
1164158568 19:22611482-22611504 GTCTGTGTGCAGAGGCTGGGAGG + Intergenic
1164503789 19:28841451-28841473 CCCTCTGTCCAGAGGGGGCGGGG + Intergenic
1164646572 19:29862684-29862706 CCCTTGTGGCAGAGAGTGGGTGG + Intergenic
1164902910 19:31943210-31943232 CCCTTTGTGCTCAGAATGGGAGG - Intergenic
1165081654 19:33310371-33310393 TACTTTGTGGAGAGAGTGGGGGG - Intergenic
1165867252 19:38946336-38946358 CCCTTTGTGATGAGGCTGAGAGG - Intronic
1165941392 19:39416400-39416422 TGCTTCGTGCAGAGGGTGAGTGG + Exonic
1166119552 19:40677420-40677442 CCCTATGGGGAGAGGATGGGCGG + Exonic
1166668706 19:44697324-44697346 CTGTTTGTGCAGTGGGTGGGGGG - Intergenic
1168345447 19:55648401-55648423 CCCTTTGTCCCGCGGGTGGGAGG - Exonic
925141210 2:1550895-1550917 CGCTTTGGGGAGAGGCTGGGCGG - Intergenic
925586135 2:5466075-5466097 CCCTTTCTGGAGAGGGGCGGGGG + Intergenic
926010540 2:9402671-9402693 CTTTTTGTGGAGTGGGTGGGGGG - Intronic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
927492919 2:23532438-23532460 CCCTGGGTGCAGAGGGTGCGTGG - Intronic
928121633 2:28587941-28587963 GCCTGTCTGCAGAGGCTGGGAGG - Intronic
929803953 2:45128242-45128264 GGCTTTTTGCAGAGGGTGGATGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931429361 2:62196592-62196614 CCCTCTGGGCTGAGGTTGGGTGG - Intronic
931723286 2:65083186-65083208 CCCTTTGTGCAGGGCAGGGGTGG - Intronic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
933610378 2:84428225-84428247 GCATTTGTGGGGAGGGTGGGAGG - Intronic
935744589 2:106179295-106179317 GCCTTTGTGGAGAGGGTCAGGGG - Intronic
937360076 2:121223582-121223604 CCCTTTGTGGGGAGGTTAGGGGG - Exonic
937655369 2:124368732-124368754 AACTTTGTGCTGGGGGTGGGAGG + Intronic
940516845 2:154694148-154694170 CCCGTTGTGCAGAGGCCAGGAGG - Intergenic
940598772 2:155829631-155829653 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
942541275 2:177017771-177017793 CCCTGGGGACAGAGGGTGGGAGG + Intergenic
944959608 2:204856157-204856179 ACCTTTGTGTAGAGTGTTGGTGG - Intronic
946836338 2:223776384-223776406 CCCATTGTGAAGTGGGAGGGTGG - Intronic
946884848 2:224212826-224212848 CCCTGAGGGTAGAGGGTGGGAGG - Intergenic
948137246 2:235645680-235645702 CCCTTCCTGCAGAGGGAGGTGGG + Intronic
1168944289 20:1738735-1738757 CCCTCCCTGCAGAGGGTGGGGGG + Intergenic
1168978652 20:1986816-1986838 CCCTTTGTGCAAAGGCTTGGAGG - Intronic
1169764570 20:9135130-9135152 CACATTGTGCAGAAGTTGGGAGG - Intronic
1172181721 20:33007837-33007859 ACCCTTCTGCAGAGGGTGGCTGG - Intronic
1172823733 20:37761992-37762014 GCCTTGGTGAAGAGGTTGGGTGG + Intronic
1173048523 20:39536341-39536363 CCTTTTGTGCAAAGGGAAGGTGG + Intergenic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1174365724 20:50055143-50055165 CCCTCTGTGCGTGGGGTGGGGGG - Intergenic
1178919065 21:36726728-36726750 CCCTGTGTGCGGTGTGTGGGGGG + Intronic
1180945258 22:19689024-19689046 GCCTGTGAGCAGAGGGTGGCAGG - Intergenic
1181059265 22:20274114-20274136 GGCATTGAGCAGAGGGTGGGTGG - Intronic
1181407304 22:22694224-22694246 TCCTGTGGGCAAAGGGTGGGAGG + Intergenic
1181415304 22:22754993-22755015 TCCTGTGGGCAAAGGGTGGGAGG + Intronic
1181834854 22:25596053-25596075 CCCTTCTTGTAGAGGGTGGTTGG - Intronic
1183036445 22:35144262-35144284 CCCGCTGTGGAGGGGGTGGGGGG + Intergenic
1184537036 22:45094382-45094404 CCCTTTGTGCAGAGAGGAGGGGG - Intergenic
1184606341 22:45576811-45576833 CCCTGTGTGGGGAGGGTGGAGGG - Intronic
1184788063 22:46681289-46681311 GCCTGTGGGCCGAGGGTGGGTGG - Intergenic
1184923709 22:47623349-47623371 CCCTGAGTCCAGAGAGTGGGAGG + Intergenic
1184932713 22:47693028-47693050 CCCATTGTGCAGAGAGAAGGTGG - Intergenic
1185142151 22:49108528-49108550 ACCTGTGTGCAGATGGAGGGGGG + Intergenic
1185374330 22:50475102-50475124 CCATTGGTCCAGAGGGTGGGAGG + Intergenic
949533873 3:4980441-4980463 TCCTTTGCCCAGAGGGCGGGCGG + Intronic
950799822 3:15541340-15541362 CCCATGGTGCAGATGGTGGGAGG - Intergenic
954573925 3:51664322-51664344 GTCTGTGTGCAGAGGCTGGGAGG + Exonic
954590024 3:51775332-51775354 CTCCGTGTGCAGAGGGTGGCAGG - Intergenic
957618670 3:82567062-82567084 CACCCAGTGCAGAGGGTGGGAGG - Intergenic
959608412 3:108267098-108267120 CCCTTTATGCTGAGGCTGGGGGG + Intergenic
961115208 3:124323394-124323416 CCCTGTGGGCAGGGGGTGGATGG + Intronic
961450105 3:126998818-126998840 CCCTGTGTGCTGGGGGTTGGGGG + Intronic
961648561 3:128405859-128405881 CCCTTTGTGCACATGGGGAGGGG + Intronic
961808640 3:129507644-129507666 TGCTGTGTGCAGCGGGTGGGAGG - Intronic
962066128 3:131981955-131981977 CCCTTTCTTCAGAGGGTCTGTGG + Intronic
965685247 3:171295557-171295579 GACTTTGTGGAGAGGGTGAGAGG - Intronic
967234938 3:187374881-187374903 CCCAGAGGGCAGAGGGTGGGAGG - Intergenic
967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG + Intergenic
967868500 3:194210103-194210125 CTCTTTGGGCAAAGGGTGGTGGG - Intergenic
968222261 3:196947843-196947865 CCATTTGTGCAGAGGCCTGGAGG + Exonic
968653153 4:1767812-1767834 CCCTTTGTGCAGAGCTGGGGCGG + Intergenic
968728515 4:2259234-2259256 CTGTTGGTGCAGCGGGTGGGAGG - Intronic
969861704 4:10041040-10041062 CCCTTTGTGCCTTGAGTGGGAGG + Intronic
970943432 4:21662066-21662088 CCCTTTGTCCAGGTGGTGTGAGG - Intronic
971036033 4:22693739-22693761 CCCTTTGTGGAGGGGAAGGGGGG - Intergenic
973566045 4:52188650-52188672 ACCTGAGGGCAGAGGGTGGGAGG - Intergenic
974949285 4:68569221-68569243 CGCTTCCTGCAGAGGGTGTGTGG - Intronic
974958318 4:68671415-68671437 CTCTTCCTGCAGAGGGTGTGTGG - Intergenic
975895684 4:79087321-79087343 GCCTTGGCGCAGAGTGTGGGAGG + Intergenic
976291255 4:83420467-83420489 TTTTTTGTGCAAAGGGTGGGCGG - Intronic
976431692 4:84969078-84969100 CCCTTTGTGCAGAGGCCAGATGG + Intergenic
977957627 4:103048597-103048619 TCCTTTGTGCAGACGTTAGGTGG + Intronic
978441319 4:108737270-108737292 CACTTTGTGAAGAGGGTGGAGGG - Intergenic
983578917 4:169288268-169288290 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
985943826 5:3161735-3161757 CCCTGTGTGTCGAGGCTGGGAGG - Intergenic
986041193 5:3995469-3995491 CACTGTGTGCAGAGGGGGTGTGG + Intergenic
987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG + Intronic
987955246 5:24730207-24730229 CCCTTTGTTGAAAGGGCGGGGGG + Intergenic
988018847 5:25597333-25597355 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
989204322 5:38796553-38796575 TCCTCTGAGCTGAGGGTGGGTGG + Intergenic
990528366 5:56650628-56650650 GCCGTGCTGCAGAGGGTGGGAGG - Intergenic
991715754 5:69449528-69449550 CCCTTTGTGTATAGGGCAGGAGG + Intergenic
995032355 5:107494520-107494542 GCCATGGAGCAGAGGGTGGGAGG - Intronic
995843494 5:116467800-116467822 CCCTTTGCGCAGAGGCCTGGAGG + Intronic
997215165 5:132103937-132103959 TCCTTTCTGCAGTGGGTGGGGGG - Intergenic
997714146 5:136029487-136029509 CCCTTTCTGCAGTGGCTGGGAGG - Intronic
997823356 5:137085420-137085442 CTCTCTGTGCAGATGGTGAGTGG - Intronic
1000627358 5:163554309-163554331 CCCTCTGTGCAGAGTGGAGGAGG + Intergenic
1002078647 5:176724904-176724926 GCCTTTGTGGTGAGGGTGGGTGG + Intergenic
1004380923 6:15131911-15131933 GCATGTGTGCAGAGGGCGGGAGG - Intergenic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1006366423 6:33618842-33618864 TGTTTTCTGCAGAGGGTGGGAGG + Intergenic
1006392577 6:33767278-33767300 CCCTTTGGGCAGTGTGTGGTGGG + Intergenic
1006626203 6:35399718-35399740 CCCTGTATGAAGAGGGTGGTAGG - Intronic
1006981579 6:38152142-38152164 GCCTTTGTCCAGAGGATGGAGGG - Intronic
1007597498 6:43060394-43060416 ACCTGTGGGCAGAGGGAGGGAGG + Intronic
1012437114 6:99226486-99226508 CCCATGGCGCAGAGGGTGGGGGG - Intergenic
1013175263 6:107671040-107671062 CCCGTTGGGCAGAGGGATGGAGG + Intergenic
1013272280 6:108556464-108556486 TCCTTTGTGGTGAGGGAGGGAGG + Intergenic
1013592019 6:111626894-111626916 CCCTTGCTCAAGAGGGTGGGAGG + Intergenic
1016369454 6:143357124-143357146 CCCTTGGTGGAGAGACTGGGAGG - Intergenic
1016524478 6:144986186-144986208 GCCTTTGTTCTGAGGTTGGGTGG + Intergenic
1016652456 6:146478352-146478374 CTACTTGAGCAGAGGGTGGGAGG - Intergenic
1016893758 6:149032665-149032687 CCCTGGGTGCACAGGGTGGGAGG - Intronic
1017821027 6:158049222-158049244 CCCTTTGCCCAGAGGGGAGGAGG + Intronic
1019700153 7:2470892-2470914 CGCTTTGTGCTGAGGGCGGTGGG + Intergenic
1020564427 7:9777958-9777980 CCCTTTGGGGAAAGGCTGGGAGG - Intergenic
1023849824 7:44144457-44144479 CCCTTGGGGCAGAGGCTTGGGGG + Exonic
1023873832 7:44276431-44276453 CCCTTTGTGCAGTGGGTGGCGGG - Intronic
1025612519 7:63088989-63089011 CGCTTTGTGCAGAGTGTGATGGG + Intergenic
1026105328 7:67416523-67416545 CTCTTTGTGCAGTGGGAGGCTGG + Intergenic
1029337534 7:99915190-99915212 CCAGTTGGGCTGAGGGTGGGAGG - Intronic
1029440339 7:100583740-100583762 ACCGTTCTGGAGAGGGTGGGGGG + Intronic
1029595496 7:101535535-101535557 CCCTTGGTGGAGAGGGTGTCAGG - Intronic
1031134547 7:117872220-117872242 CCCTACCTCCAGAGGGTGGGAGG + Intronic
1032589046 7:133175438-133175460 CTCTTTGGGTAGAGGGTGGTGGG - Intergenic
1034921571 7:155087615-155087637 CCCACTGTGCCGGGGGTGGGGGG + Intergenic
1035769123 8:2132914-2132936 CCTTATGTCCACAGGGTGGGAGG + Intronic
1035842667 8:2829150-2829172 CCCATTCTGGGGAGGGTGGGTGG + Intergenic
1035845123 8:2855091-2855113 CCCTGTGTGTTGAGGGAGGGAGG + Intergenic
1035973788 8:4284372-4284394 CTCTTTTTGGGGAGGGTGGGTGG - Intronic
1036764883 8:11543158-11543180 CCCTCTGTGCAGAGGATCTGAGG + Intronic
1037438405 8:18888998-18889020 CCCCATGTGAAGATGGTGGGTGG - Intronic
1039454799 8:37699357-37699379 CCCTATGCGCGGAGGGTGGCGGG - Exonic
1040468454 8:47716692-47716714 CACTGACTGCAGAGGGTGGGTGG + Intronic
1041089254 8:54287042-54287064 CACTTTCTGGAGATGGTGGGTGG - Intergenic
1042820091 8:72921014-72921036 CCCTTTTTGCAGAGCGCGGAAGG + Intronic
1045345180 8:101287657-101287679 GGCCTTGAGCAGAGGGTGGGGGG - Intergenic
1048206743 8:132421567-132421589 CACTTGGGGCAGATGGTGGGTGG + Intronic
1048329415 8:133461847-133461869 CCCTGTGGGCAGGGGGAGGGTGG + Intronic
1049423767 8:142528263-142528285 CGCTTTGTGCAGACGGAGGCAGG + Intronic
1049759995 8:144327611-144327633 CTCCTTGTGGAGAGAGTGGGTGG - Intergenic
1049795642 8:144496192-144496214 CCCTTTCTGGAAAGGGTGGGTGG + Intronic
1049827719 8:144680327-144680349 CTCCTTGTGCAGAGGCTGTGCGG - Intergenic
1050530587 9:6585535-6585557 CCCTTTGGGAAGAGGGTATGTGG - Intronic
1051596177 9:18826335-18826357 GCCTTCGTGCAGATGGTGCGGGG - Exonic
1051706781 9:19889142-19889164 AACTTTGTGCAGAGATTGGGTGG - Intergenic
1051745804 9:20293566-20293588 CCCTTTGACCAGAGTGAGGGTGG - Intergenic
1052651693 9:31311667-31311689 CCCGGTGGGCAGGGGGTGGGTGG - Intergenic
1053395290 9:37768179-37768201 CCCTTTATGAAGAGTGTGTGAGG + Exonic
1057178434 9:93016069-93016091 CCCTTTCTGCAGAGCCTTGGAGG + Intronic
1057726235 9:97570584-97570606 CTCTTTGGGCAGAGGTTTGGAGG - Intronic
1057904911 9:98975832-98975854 CCCTTTTTGCAGAGTGAGAGTGG + Intronic
1058168669 9:101651565-101651587 CTCTTTGTGCATAGGGTCTGTGG - Intronic
1058428812 9:104900049-104900071 CCCATTGTGCAGACTGAGGGGGG - Intronic
1060896049 9:127218309-127218331 AGGTGTGTGCAGAGGGTGGGTGG - Intronic
1061072981 9:128323073-128323095 CCCTTTCTGCAGCGGGGAGGTGG - Exonic
1061084593 9:128391695-128391717 CCCTGGCTGCAGAGAGTGGGAGG + Exonic
1061601781 9:131675067-131675089 CCCTTTCCACAGAGGGTGGTGGG + Intronic
1061681565 9:132245055-132245077 CCCCTGGTGCAGAAGGTGGGCGG + Intergenic
1062145155 9:134984972-134984994 CCATGTGTGCAGAGGGTGTCTGG + Intergenic
1062278963 9:135743571-135743593 CCCATGGTGCAGAGGGTGACGGG + Intronic
1062325644 9:136011219-136011241 CCCTTCTTGGGGAGGGTGGGAGG - Exonic
1062325708 9:136011586-136011608 CCCTTTGAGCAGGGCGGGGGCGG - Exonic
1189267218 X:39726055-39726077 CCCTGTGTGCAGGGGCTGGCAGG + Intergenic
1190136375 X:47803186-47803208 CACTCTGTGCAGAGACTGGGCGG + Intergenic
1190416167 X:50182614-50182636 CCCACTTTACAGAGGGTGGGTGG - Intergenic
1190599845 X:52079369-52079391 CCTTTTGTGGAGAGTGTGGGTGG + Intergenic
1192095532 X:68206823-68206845 CCCTGTGTGCAGTAGGTAGGTGG - Intronic
1194609172 X:96019583-96019605 CACCTTGTTCAGAGGGTGGCAGG - Intergenic
1195996543 X:110737411-110737433 CACTTTGAGTAGAGGGTTGGTGG - Intronic
1198119825 X:133580915-133580937 CCATATGGGCAGAGGTTGGGAGG - Intronic
1199425247 X:147693301-147693323 TGCTCTGTGCAGAGAGTGGGAGG - Intergenic