ID: 1073297621

View in Genome Browser
Species Human (GRCh38)
Location 10:102450700-102450722
Sequence GGGCCGCGTGGAGCGCGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073297621_1073297630 18 Left 1073297621 10:102450700-102450722 CCCGCGCGCGCTCCACGCGGCCC 0: 1
1: 0
2: 3
3: 26
4: 282
Right 1073297630 10:102450741-102450763 AGGCTCCCGCCCTCCGGCCACGG 0: 1
1: 0
2: 0
3: 11
4: 194
1073297621_1073297627 -2 Left 1073297621 10:102450700-102450722 CCCGCGCGCGCTCCACGCGGCCC 0: 1
1: 0
2: 3
3: 26
4: 282
Right 1073297627 10:102450721-102450743 CCCAGCGCAGCTCGGTTTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 100
1073297621_1073297624 -10 Left 1073297621 10:102450700-102450722 CCCGCGCGCGCTCCACGCGGCCC 0: 1
1: 0
2: 3
3: 26
4: 282
Right 1073297624 10:102450713-102450735 CACGCGGCCCCAGCGCAGCTCGG 0: 1
1: 0
2: 1
3: 15
4: 133
1073297621_1073297629 12 Left 1073297621 10:102450700-102450722 CCCGCGCGCGCTCCACGCGGCCC 0: 1
1: 0
2: 3
3: 26
4: 282
Right 1073297629 10:102450735-102450757 GTTTGCAGGCTCCCGCCCTCCGG 0: 1
1: 0
2: 1
3: 5
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073297621 Original CRISPR GGGCCGCGTGGAGCGCGCGC GGG (reversed) Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900414809 1:2530071-2530093 AGGCCGCGGGGACAGCGCGCCGG + Intronic
900583501 1:3421067-3421089 GGGCCGCGTGCAGCCCCCGATGG - Intronic
900626585 1:3611370-3611392 GGGCTCCGCGGAGCGGGCGCGGG - Exonic
903078106 1:20787333-20787355 GGGCCGGCGGGGGCGCGCGCGGG - Intergenic
903750186 1:25616711-25616733 GGGGCGCGGGGCGCGCGCGTGGG + Intergenic
903828602 1:26161795-26161817 CTGCGGCCTGGAGCGCGCGCTGG + Exonic
904199742 1:28812113-28812135 GGGCCACGTGGTGCGCGCGGCGG + Intergenic
906264367 1:44417520-44417542 GCGCGGCGTGGAGCGAGGGCAGG - Intronic
908544080 1:65147766-65147788 GGGCCCCTCCGAGCGCGCGCGGG + Intronic
912069845 1:105795931-105795953 GGGCTGCGCGGGGCGCTCGCTGG + Intergenic
912246327 1:107965098-107965120 GGGGCGCACGGAGAGCGCGCGGG - Exonic
912824668 1:112894720-112894742 GGGCTGCGTGTGGCGCTCGCGGG + Intergenic
915629201 1:157138554-157138576 GGGCCGGGAGGAGCGCGCAGGGG - Intergenic
916048789 1:161020658-161020680 GGTGCGTGTGGAGCGCGCGCTGG + Intronic
917105338 1:171485848-171485870 GGGCCGCGTGGAGAGGGCCTTGG + Intronic
917846616 1:179025803-179025825 GGGCCGCGCCGAGCGAGCGCTGG + Intronic
918853242 1:189718636-189718658 GGGCTGCGTGCAGCGCTTGCGGG - Intergenic
920150197 1:203900258-203900280 GGGCTGCGTGCAGCGCTTGCAGG + Intergenic
921060391 1:211579478-211579500 GGGCCGCGTGCAGCGGGAGGGGG + Intergenic
922739375 1:228006886-228006908 GCGCCGCGGGGGGCGCCCGCCGG - Intergenic
1064197757 10:13259627-13259649 GGGCTGCGTGCAGCGCTTGCGGG + Intergenic
1065022348 10:21510443-21510465 GGGCCGGCCGGAGCGCGGGCTGG + Intergenic
1066303219 10:34115182-34115204 GGGCCTCGTGGAGAGAACGCGGG + Intronic
1067110678 10:43397358-43397380 CGGCCCCGTGGCCCGCGCGCTGG + Intronic
1067694174 10:48523630-48523652 GGGCGGCGCAGGGCGCGCGCCGG + Intronic
1070942589 10:80359828-80359850 GGGCCGCGTGTGGCACTCGCAGG - Intronic
1071086835 10:81875266-81875288 GGGCCGCGCGGGCCGGGCGCGGG - Intergenic
1071387972 10:85141421-85141443 GGGCTGCGTGCAGCGCTTGCGGG + Intergenic
1073297621 10:102450700-102450722 GGGCCGCGTGGAGCGCGCGCGGG - Exonic
1074999201 10:118782924-118782946 GGGCTGCGTGCAGCGCTTGCGGG + Intergenic
1076902400 10:133346463-133346485 GGGCCCCGTGGAGCGGGCCCTGG + Intronic
1077247956 11:1548280-1548302 GGGGCGCGTGGAGCCTGCGCTGG - Intergenic
1077331904 11:1987528-1987550 GGGCCGGGTGGAGTGGGCGATGG + Intergenic
1078354957 11:10626343-10626365 TGGCCCCGTGGAGAGCGAGCTGG - Exonic
1078795791 11:14591084-14591106 GGGCTGCGTGCAGCGCTTGCGGG + Intronic
1080283820 11:30586150-30586172 GGGCGGCGAGGGGCGCGAGCGGG + Intronic
1082810491 11:57476542-57476564 CGGCCTCGCGGAGCGCGCGCAGG - Exonic
1085353484 11:75815567-75815589 GGCCCGCGTGGAGAGCTTGCTGG + Intronic
1087672845 11:101127862-101127884 GGAACGCGGGGAGCGCGCGGAGG + Exonic
1088462165 11:110093303-110093325 GGCCCGCGGAGAGGGCGCGCGGG + Intergenic
1088893021 11:114059483-114059505 GTGGGGCGGGGAGCGCGCGCGGG + Intergenic
1088991951 11:114961266-114961288 GGACAGCGTGGTGCGCGCACTGG + Intergenic
1089243130 11:117098439-117098461 GGGCCGCGGGGAGCCGGCTCGGG + Intergenic
1090817952 11:130314959-130314981 GGGCGGGGCGGAGCGCGCTCGGG + Intergenic
1091225852 11:133956251-133956273 GCGCCGCGAGGAGCGCCTGCAGG - Intronic
1091286706 11:134412120-134412142 GGGGAGCGGGGAGCGGGCGCGGG + Intergenic
1202814885 11_KI270721v1_random:42704-42726 GGGCCGGGTGGAGTGGGCGATGG + Intergenic
1091616371 12:2053670-2053692 GGGCCGCGGGGAGCGCGGGTAGG - Intronic
1092220266 12:6708331-6708353 GGGCTGCGTGGGGCGCTTGCGGG + Intergenic
1092221368 12:6716058-6716080 GGGCTGCGTGGGGCGCTTGCGGG + Intergenic
1094564755 12:31590183-31590205 TGGCCGTGCGGAGCGAGCGCGGG - Intronic
1096460926 12:51821204-51821226 GCGCCGCCTTGAGCGCGCCCTGG + Intergenic
1096634313 12:52948956-52948978 GGGCTGCGCGGAGGGCGCGGGGG + Exonic
1100211918 12:92406857-92406879 GGGCTGCGTGCAGCGCTTGCGGG - Intergenic
1101021591 12:100559403-100559425 GGGCTGCGTGCAGCGCTTGCAGG + Intronic
1102025772 12:109713764-109713786 GGGCCGCGGGGGGCGGGCGGGGG + Intergenic
1102205076 12:111084783-111084805 GGGCCACGTGGCGGGCGGGCTGG + Intronic
1102310632 12:111842158-111842180 GGGCGGCCTGGAGCTCCCGCGGG + Intronic
1102519810 12:113471266-113471288 CGCCCCAGTGGAGCGCGCGCAGG + Intronic
1103120681 12:118376935-118376957 GGGCTGCGTGGAGGGGCCGCCGG + Intronic
1103474776 12:121210308-121210330 GGGCCGCGCGGGGGGCGCGGCGG + Intronic
1104836834 12:131797274-131797296 GGGCCGCGGGGGCCGCGGGCCGG - Exonic
1104891962 12:132144482-132144504 GGGCGGCATGGAGCGGGAGCCGG + Exonic
1106168704 13:27270931-27270953 CGGCCGCATGGAGCGCGTCCCGG - Exonic
1106208387 13:27620430-27620452 GGGCCGCGGAGAGCGGGAGCTGG - Intergenic
1109829980 13:67773260-67773282 GGGCTGCGTGCAGCGCTTGCAGG - Intergenic
1110999875 13:82165289-82165311 GGGCTGCGTGGGGCGCTTGCGGG - Intergenic
1112505467 13:99972053-99972075 GCACCTCGCGGAGCGCGCGCCGG + Intergenic
1113660701 13:112104903-112104925 GCGCCTCGCGGAGCGCGCGGGGG + Intergenic
1114629050 14:24147634-24147656 GGGCCGCGCGCTGCCCGCGCCGG + Exonic
1118351017 14:64972396-64972418 AGGGGGCGGGGAGCGCGCGCAGG + Intronic
1119260858 14:73237490-73237512 GGGCCGCAAGGAACGCCCGCAGG - Exonic
1122155227 14:99746693-99746715 GGGCTGCGTGGAGGGGGCCCAGG - Intronic
1122220809 14:100238451-100238473 GGGCCGCGCGGACCGCTCACCGG + Intronic
1122629779 14:103102365-103102387 GGCCCGCGTGGTGAGCGCGGAGG + Exonic
1122688971 14:103522679-103522701 GCGTCGCCTGGAGCGCGCGCCGG - Intronic
1122779127 14:104136289-104136311 GCGCGGCGCGGAGCGAGCGCAGG + Intergenic
1122910960 14:104827348-104827370 GGGCTGCGAGGAGGGCGCCCAGG + Intergenic
1123004460 14:105314697-105314719 GGGGCGCGCGGGGCGCGGGCGGG + Exonic
1124109523 15:26773140-26773162 GGGGAGGGAGGAGCGCGCGCGGG + Intronic
1127117468 15:55742735-55742757 GGGGCGTGGGGAGCGCGCGGCGG - Intronic
1127460016 15:59190147-59190169 GGGCTGCGTGCTGCGCGAGCTGG + Intronic
1127606463 15:60592317-60592339 GGGCGGGGAGGAGGGCGCGCAGG - Intronic
1127931648 15:63600994-63601016 GGGCCGCGGCGGGCGCGCGCGGG - Intronic
1128866034 15:71115726-71115748 GGGCCGCGCGGGCGGCGCGCAGG - Intronic
1130224594 15:82047125-82047147 GGGCGCTGCGGAGCGCGCGCCGG + Intergenic
1131819908 15:96261929-96261951 GGGCGGGGTGGAGAGCGGGCAGG - Intergenic
1132519897 16:382100-382122 GGGTCACGTGGGGCGCGCGGGGG + Intronic
1132634981 16:939616-939638 AGGCCGCGTGGAGAGTGGGCCGG - Intronic
1132832043 16:1933192-1933214 GGGGCGCGTGGGGCGGGTGCTGG - Intergenic
1133219954 16:4315747-4315769 CGGCCGCGGGGAGCGGGCACCGG - Intronic
1135023837 16:18984134-18984156 GGGCGGCAGGGAGCGCGCGCGGG + Intronic
1135340069 16:21637701-21637723 GGGCTGCGCGCAGCGCACGCGGG - Intronic
1136913003 16:34159577-34159599 GGTCGGCGTGCAGCGCGCGCAGG + Intergenic
1137267973 16:46884353-46884375 GGGCCGGGCGGCGCGGGCGCCGG + Intergenic
1139387054 16:66579433-66579455 GGCGCGCGTGGAGAGGGCGCGGG + Intronic
1139402818 16:66696216-66696238 GGGGCGCGAGGAGCGGGCTCCGG + Intronic
1139465052 16:67150038-67150060 GGGTCGCGTGCAGGGGGCGCTGG - Exonic
1139529795 16:67537533-67537555 GGTCCGCGGGGGGCGAGCGCGGG + Intronic
1140209571 16:72959825-72959847 GGGTGGCGGGGGGCGCGCGCTGG + Exonic
1140442672 16:74999385-74999407 GTGGCGCGCGGAGCCCGCGCCGG + Exonic
1141184748 16:81779346-81779368 GGGACGCGGGCTGCGCGCGCGGG + Exonic
1142233738 16:88911749-88911771 CGGCCGCGTGGAGCTGGTGCAGG + Intronic
1142696548 17:1636981-1637003 GGGCAGCGTGGAGCCCAAGCTGG + Exonic
1144021417 17:11242067-11242089 GCGCCGCGTGCCGCGCGCCCCGG + Intronic
1144695827 17:17303425-17303447 GGCGCGCGTGGAGCGCGGGACGG - Exonic
1146054175 17:29572984-29573006 CTGCCACGTGGACCGCGCGCGGG + Exonic
1146646876 17:34581760-34581782 GGGCCGCGGGCCGCGCGCGGAGG + Intronic
1147139672 17:38453996-38454018 GTGGCGCGTGGAGCGCGCGGGGG + Intronic
1147702510 17:42404788-42404810 GGGCGGCGCGGAGCGCGGGGAGG - Exonic
1148323509 17:46771115-46771137 GGGCCGCGGAGAGCGGCCGCGGG - Intronic
1148615798 17:48998559-48998581 GGGCCGAGAGGCGCGCGCGGTGG + Intronic
1149539172 17:57455761-57455783 GGGCCGCGTGGAGTGCCCAGCGG + Intronic
1150778245 17:68099305-68099327 GGGCTGCGTGCAGCGCTTGCGGG + Intergenic
1151649461 17:75457157-75457179 CGGCTGCGGAGAGCGCGCGCAGG - Intronic
1152049024 17:77958511-77958533 GGGCCGGGAGGGGCGCGCGGGGG + Intergenic
1152680674 17:81666382-81666404 GAGCCGGGAGGATCGCGCGCTGG - Exonic
1152708941 17:81860596-81860618 GCGCCGCGGCCAGCGCGCGCGGG - Exonic
1152801797 17:82334102-82334124 GGGCCGCGGGGAGGGAGGGCGGG + Intergenic
1153006232 18:500662-500684 GGAGCGCGGGGAGCGCGGGCCGG - Exonic
1153644090 18:7179004-7179026 GGGCGGCGTGCGGCGCTCGCGGG - Intergenic
1154012667 18:10589187-10589209 GGGCCACCTGGAGCCCACGCTGG - Intergenic
1155053245 18:22165761-22165783 GGACCGCGCGGAGCCAGCGCCGG - Intergenic
1155654465 18:28177576-28177598 GCGCCGCGGGGAGGGCGCTCCGG + Intergenic
1157085936 18:44580755-44580777 GGGCTGCGTGCAGCGCTTGCGGG + Intergenic
1159947810 18:74457155-74457177 TCGCCGCGTGGACCGCGGGCTGG - Exonic
1160025476 18:75211935-75211957 GCGCCGCGGGGAGTGGGCGCCGG + Intronic
1160732840 19:649090-649112 GGGCCCCTTGGAGCCCGCCCGGG + Intronic
1160789496 19:917103-917125 GGGCCGCGTGGAGGCCGCTGTGG - Intergenic
1160872990 19:1285610-1285632 GGGCCGGGTGGAGCGCGTGGGGG + Intergenic
1160919661 19:1513596-1513618 CGGCCCCGTGGGCCGCGCGCGGG + Intronic
1161266349 19:3366503-3366525 AGGCGGCGAGGAGAGCGCGCCGG + Intronic
1161388100 19:4007640-4007662 GCGGCGGGAGGAGCGCGCGCGGG + Exonic
1161510892 19:4670383-4670405 GGGACACGTGGAGCGTCCGCCGG + Intergenic
1162410535 19:10502765-10502787 GGGAGGCGCGGAGCGCGCGCAGG + Intronic
1162573078 19:11483578-11483600 GGGCCGCCCGGACCGCGGGCCGG - Exonic
1163118041 19:15200086-15200108 TGGCCGCGGGGAGGGGGCGCTGG + Intronic
1163159751 19:15457561-15457583 GGGCCGCGTGGCCCTGGCGCTGG - Exonic
1163804134 19:19385947-19385969 GGGCGGCGCGGGGCGCGCTCGGG - Exonic
1165157440 19:33796795-33796817 GGGCCGCGTGAAGCGGGGGCCGG + Intronic
1165431389 19:35775488-35775510 CGCCCCCGTGGGGCGCGCGCCGG + Intronic
1165838193 19:38771894-38771916 GGGCCGCGAGGAGCGCGGGCCGG - Exonic
1165841372 19:38790803-38790825 GGGCCGCGAGGAGCGCGGGCCGG + Exonic
1166084684 19:40467074-40467096 GGGGCGCGGGGACCGCGGGCGGG + Intronic
1166139723 19:40799457-40799479 TGGGGGCGGGGAGCGCGCGCCGG + Intronic
1167445387 19:49534202-49534224 GGACCGCATGGACCGCGCGGGGG + Exonic
1167613411 19:50518069-50518091 GGGCCGCGAGGAGCGCGGGGCGG + Exonic
1168239200 19:55080822-55080844 GGGCCGCGGGGAGCGCAGGGCGG + Exonic
1168293875 19:55369653-55369675 GGGCTGCGGGGAGCGAGCTCCGG - Intronic
926268191 2:11344704-11344726 GGGCGGGGCGGAGCGCGCGCAGG - Intronic
929379653 2:41335612-41335634 GGGCTGCGTGCAGCGCTTGCGGG + Intergenic
929936539 2:46297820-46297842 GGGCCGCGGGGAGCGGACGAGGG + Exonic
930585195 2:53259829-53259851 AGGCTGCGTGCAGCGCTCGCGGG - Intergenic
931253775 2:60553841-60553863 GGGCCGAGGGGAGGGGGCGCTGG + Intergenic
931291947 2:60881397-60881419 GGCCGGCGGGGAGCGTGCGCGGG + Intergenic
932042813 2:68318811-68318833 GGGCCGCCTGGACCGCGCGCAGG + Intronic
932521742 2:72421850-72421872 GGGCTGCGTGCAGCGCTTGCGGG + Intronic
933791678 2:85888619-85888641 GGGCCGTGTGGACCGGGCGGGGG - Intronic
933876059 2:86623187-86623209 GGGGCGCGGGGAGAGCTCGCGGG + Exonic
934661313 2:96145093-96145115 GGTCCGCGGGGAGCTGGCGCGGG - Exonic
936388788 2:112054575-112054597 GGGCCGCGTGGAGGCGGGGCCGG - Intergenic
936585811 2:113756664-113756686 GGGCCGCGCGGAGGGCAAGCCGG - Exonic
937208634 2:120253007-120253029 GGGCGGGGTGGGGCGCGGGCTGG + Intronic
937746566 2:125422268-125422290 GGGCTGCGTGCAGCGCTTGCGGG + Intergenic
938451573 2:131425432-131425454 CGGCGGCGAGGAGCGGGCGCGGG - Intergenic
941712157 2:168725236-168725258 GGGCTGCGTGCAGCGCTTGCAGG - Intronic
942540152 2:177007874-177007896 GGGCTGCGTGCAGCGCTTGCGGG + Intergenic
942890484 2:180980993-180981015 GGGCCGCGTGGGGGGCGGCCGGG + Intronic
944114271 2:196171016-196171038 CGGCCGGGTGGAGGGCGCACGGG + Intronic
946395554 2:219442165-219442187 GGGCCCGGTGGAGGGGGCGCTGG + Intronic
946412696 2:219522946-219522968 GGGCGGCGAGGCGCGCGAGCCGG + Intronic
947549699 2:231037559-231037581 GGCCAGCATGGAGCGCGAGCTGG + Exonic
947741388 2:232486564-232486586 GCGGCGCGGGGGGCGCGCGCGGG - Exonic
947860641 2:233354890-233354912 GGGCCGGGCGGGGGGCGCGCAGG + Intronic
948208126 2:236173491-236173513 GGGCCGCGTGAACCGCGGCCTGG + Intergenic
948562591 2:238864522-238864544 GGGCCGGGTGGGGCGCGCCTTGG - Intronic
948801600 2:240435798-240435820 GGACCGCGAGCCGCGCGCGCCGG + Exonic
948874476 2:240819599-240819621 GGCCCGAGGGGAGAGCGCGCAGG - Intronic
948895675 2:240925823-240925845 GGGCAGCGTGCAGCGCCTGCAGG + Exonic
1168757098 20:325506-325528 GGGAGGGGTGGTGCGCGCGCCGG + Exonic
1168804424 20:664156-664178 GGGGCGCGCGGGGCGCGCGGGGG - Exonic
1168965318 20:1894940-1894962 GCGCCGTGTGGAGCCCGGGCGGG + Intronic
1170890279 20:20369644-20369666 GGGCGGCGTGCAGCAGGCGCAGG - Exonic
1170999433 20:21397421-21397443 GGGGGGCCTGGGGCGCGCGCCGG + Exonic
1171010471 20:21506501-21506523 GGGGCGCGTGGAGCGTACGCGGG + Intergenic
1171968329 20:31547405-31547427 AGGCCGCGTGGCGCCCGCGCCGG + Intronic
1171972567 20:31573286-31573308 GGGCTGCCAGGAACGCGCGCAGG + Intronic
1175429479 20:58891548-58891570 GGGCCGCGGGGCGCGCGGACGGG - Intronic
1176005627 20:62861057-62861079 GGGCCGCGCGGCGCGGGCGGCGG + Exonic
1176237886 20:64062789-64062811 AGGCCAAGTGGGGCGCGCGCAGG + Intronic
1176380994 21:6111874-6111896 GGTCCGGGTGGAGCGGGCGGCGG + Intronic
1179243839 21:39613090-39613112 GGGGCGCGGGGAGCGCTGGCCGG + Intronic
1179411842 21:41168337-41168359 GGGCAGCGTGAAGGGCGCGGGGG - Exonic
1179742478 21:43426366-43426388 GGTCCGGGTGGAGCGGGCGGCGG - Intronic
1180342426 22:11629053-11629075 GGTCGGCGTGCAGCGCGCGCAGG + Intergenic
1180699714 22:17774553-17774575 GGGACCCGGGGAGCCCGCGCCGG + Intronic
1180791491 22:18577726-18577748 GGGTCGCGGGGAGCGGGCGGGGG - Intergenic
1181017642 22:20080392-20080414 GGGGCGCGAGGGGCGCCCGCGGG + Intronic
1181230248 22:21417585-21417607 GGGGCGCGGGGAGCGGGCGGGGG + Intronic
1181248402 22:21517278-21517300 GGGTCGCGGGGAGCGGGCGGGGG - Intergenic
1181831634 22:25564886-25564908 GGGGCGCGCGGCGCGCGCGCGGG + Exonic
1182903986 22:33920860-33920882 GGGAGGCGGGGATCGCGCGCCGG - Intronic
1183228227 22:36564585-36564607 GGGCTCCGTGGAGCGCGAGCTGG + Exonic
1183683673 22:39349909-39349931 GGGCCGCCGGCCGCGCGCGCAGG + Intronic
1184022901 22:41833060-41833082 GGGCCGCAGGGGGCGCGGGCTGG + Intronic
1184101456 22:42343631-42343653 GGGGCGCGCGGGGCCCGCGCTGG - Intergenic
1184265281 22:43343064-43343086 GGGCCGCGCGGGGCGAGCTCGGG + Intronic
1184472236 22:44702427-44702449 GCGCGGCGTGGGGCGCGCGTGGG + Intronic
1184545564 22:45164603-45164625 GGGCCGGGCGGGGCGCGCGGTGG + Intronic
1185278596 22:49960578-49960600 GGGCCGGGTGCGGCGGGCGCGGG - Exonic
1185342930 22:50299685-50299707 GGACTGGGTGGAGAGCGCGCGGG + Intronic
950487549 3:13282272-13282294 GGGCCGCGCGGATCCCGCCCTGG - Intergenic
950729751 3:14947466-14947488 GGGCCGGATGGACCGAGCGCCGG + Intergenic
953485115 3:43287039-43287061 GGGCCGAGTGCGGCGCCCGCGGG + Intronic
953925209 3:46979362-46979384 GGGCCGCGTGGAGGTGGCGAGGG - Intronic
954707296 3:52487889-52487911 GGTCCGCGTGGAACTCGTGCAGG - Exonic
961473964 3:127135665-127135687 GGGCCGCGGGGAGGGTGCGGGGG - Intergenic
964983184 3:162710848-162710870 GGGCTGCGTGCAGCGCTTGCAGG - Intergenic
965652327 3:170947245-170947267 GGGCTGCGTGCAGCACTCGCAGG + Intergenic
966886413 3:184380089-184380111 CGGCCGGGAGGAGCGCGGGCGGG - Exonic
968051554 3:195658240-195658262 GGTCCGAGCGGAGCGGGCGCCGG + Intergenic
968104263 3:195990093-195990115 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
968302564 3:197627683-197627705 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
968549740 4:1216107-1216129 GGATGGCGTGGAGCGGGCGCTGG - Exonic
968662165 4:1803167-1803189 GCCCCGAGTGGAGCGCGAGCCGG - Intronic
969436742 4:7193135-7193157 GGGCCGCGGCGAGCGCGTGGAGG - Intronic
972245908 4:37245078-37245100 GGGCAGCTTGGTGCCCGCGCCGG - Exonic
973531872 4:51843434-51843456 GGGCGGCGTGGGGCGGGGGCGGG + Intronic
973635948 4:52862228-52862250 GGGCCTCGTGTAGGGCGCCCCGG + Intergenic
976092346 4:81471645-81471667 GGGCCGCGCGGGGAGCGAGCGGG - Intronic
976520661 4:86021946-86021968 GGGCCGCGTGCGGCGCTTGCGGG - Intronic
978466222 4:109012496-109012518 GGGCTGCGTGCAGCGCTCGTGGG + Intronic
982042373 4:151409055-151409077 AGGCCTCGGGGAGCGCGCCCCGG - Intergenic
982692749 4:158566966-158566988 GGGCTGCGTGCAGCGCTTGCAGG + Intronic
983835422 4:172377874-172377896 GTGCTGCGTGCAGCGCTCGCGGG - Intronic
983935683 4:173501183-173501205 GGGCCGCGTGGCTCGCACCCCGG - Intergenic
985497622 5:218493-218515 GGTCCGAGCGGAGCGGGCGCCGG + Intronic
985896096 5:2750923-2750945 GGGACGCGCGGGGGGCGCGCGGG + Intronic
986151969 5:5137808-5137830 GGGCTGCGTGCAGCGCTTGCGGG + Intergenic
986697964 5:10375181-10375203 GGGCTGCGTGCAGCGCTTGCGGG + Intronic
987088071 5:14487788-14487810 GGGCCGCCTGCTGGGCGCGCTGG - Exonic
987315263 5:16717974-16717996 GGGCTGCGTGCAGCGCTTGCGGG + Intronic
988035612 5:25823650-25823672 GGGCTGCATGCAGCGCTCGCGGG - Intergenic
988993454 5:36693026-36693048 GGGCCGCTGGGAGAGCCCGCGGG - Intergenic
989777355 5:45225656-45225678 GGGCTGCGTGCAGCGCTCCCAGG + Intergenic
992828184 5:80569865-80569887 AGCTCGCGTGGAGCGCGCCCCGG + Intronic
996221370 5:120936843-120936865 GGGCTGCGGGGAGTGCTCGCTGG + Intergenic
997654238 5:135543856-135543878 CGCCCGCGTGGAGCGAGAGCCGG + Intergenic
998295676 5:140966940-140966962 GGGCAACGTGGCTCGCGCGCTGG + Exonic
1002485263 5:179530717-179530739 GGGCCGAGGGGGGCGAGCGCTGG - Intergenic
1002600655 5:180352660-180352682 GGGTCGCGAGGAGGACGCGCAGG + Intronic
1002688288 5:181032500-181032522 GGGCTGCGTGCGGCGCTCGCTGG + Intergenic
1002897945 6:1390004-1390026 GGGCGGCCTGGAGCGCGCCGGGG - Exonic
1003060693 6:2860167-2860189 GGGCTGCGTGCAGCGCTTGCTGG + Intergenic
1003882079 6:10488073-10488095 GGGCTGCGTGCAGCGCTTGCGGG - Intergenic
1004233737 6:13855054-13855076 GGGCCGCGCGCAGCGCTTGCGGG - Intergenic
1004906966 6:20245107-20245129 GGGCTGCGTGCAGCGCTTGCCGG - Intergenic
1006472710 6:34237470-34237492 GGGCCGCGCGGCGCGGGGGCGGG + Intronic
1007633575 6:43285472-43285494 GGGCCGCGGGTGGCGCGCGTCGG - Exonic
1013359556 6:109382009-109382031 GGGCCGGGTGGGGAGCGCGCTGG - Intronic
1017470551 6:154733791-154733813 TGGCCGCGAGGAGGGGGCGCTGG - Intronic
1018652886 6:166006108-166006130 GGCCCGCGAGGGGCGCGCGAGGG - Intergenic
1019298509 7:291198-291220 GGGCCGAGGGGTCCGCGCGCGGG + Intergenic
1019379626 7:714053-714075 GGGCCGCGGGGAGCACGTGATGG - Intronic
1019475560 7:1242481-1242503 GGGCTGCGGGGAGCGAGCGCGGG + Intergenic
1021998332 7:26201613-26201635 GGGCCGCGCGCCGCGCCCGCTGG - Intronic
1022088144 7:27088436-27088458 GGGCTGCGGGGAGCGGGCGGGGG - Intergenic
1023773758 7:43583627-43583649 GCGGCGCGTGGAGGGGGCGCTGG - Intronic
1024269042 7:47628500-47628522 GGGCTGCGTGCAGCGCTTGCTGG + Intergenic
1024579755 7:50792729-50792751 GGGCCGCGGCGCGCGCGCCCGGG - Intronic
1026890130 7:73977017-73977039 GGGCCGAGGGGAGGGAGCGCGGG + Intergenic
1028417672 7:90596746-90596768 AGGCCGAGGGGAGCGGGCGCTGG - Intronic
1029535273 7:101154332-101154354 ACGCCGCGGGGAGCGCGGGCGGG - Intergenic
1032074860 7:128831482-128831504 GGGCCGAGGGGAGCTGGCGCGGG + Intronic
1032344360 7:131105946-131105968 GGGCGGCGGCGGGCGCGCGCGGG + Intergenic
1033300040 7:140177172-140177194 GAGGAGCGGGGAGCGCGCGCCGG - Intergenic
1034270289 7:149800357-149800379 GGGCTGCGTGGAACAGGCGCAGG + Intergenic
1034347853 7:150398041-150398063 GGGCCGCGCGGTGCACGCGCTGG - Exonic
1034424973 7:151009515-151009537 GAGCCGCGTGGAGGACCCGCCGG + Exonic
1034969468 7:155410156-155410178 GGGGCGCGGGGAGGGGGCGCAGG + Intergenic
1035022678 7:155808592-155808614 AGGCCGCGCGGAGCCCGGGCCGG - Intronic
1035530665 8:348314-348336 GGGTCGCCTGGAGCTCGAGCTGG + Intergenic
1035747611 8:1973681-1973703 AGGCTGCGAGGGGCGCGCGCGGG - Intergenic
1038963815 8:32549251-32549273 GGGCCGCCTGGAGGGAGAGCCGG + Intronic
1039875018 8:41578057-41578079 GTGCCGCGTGGACCGGTCGCGGG - Intronic
1042903021 8:73746938-73746960 GGGGCGCGCGGCGCGAGCGCGGG - Intronic
1043110089 8:76169631-76169653 GGGCTGCGTGCGGCGCTCGCGGG + Intergenic
1048981241 8:139704175-139704197 GGGCCTCGGGGAGCGGGGGCCGG + Intergenic
1049218318 8:141417753-141417775 GGGCCGCGCAGGGCGGGCGCGGG - Intronic
1049585209 8:143429830-143429852 GGGCGGCGTGGTGCGCGCCGTGG + Exonic
1050351079 9:4741469-4741491 GAGCCGAGTGGAGGGCGCGTGGG - Intronic
1051459462 9:17295167-17295189 GGGCTGCGTGCAGCGCCTGCGGG - Intronic
1053056548 9:34996391-34996413 GGGCCGAGTGGAGCGGCTGCTGG - Exonic
1053198412 9:36136902-36136924 GGTGCGGGTGGAGGGCGCGCGGG + Intronic
1055612029 9:78032432-78032454 GCGCCGCAGGGAGCGCGTGCGGG - Intergenic
1057907221 9:98992443-98992465 GGGCTGCGTGCAGCGCTTGCGGG - Intronic
1060477968 9:123999744-123999766 CGGCCGCCTGGAGTGGGCGCGGG - Intergenic
1060700586 9:125746903-125746925 GGGCCGCGGGGAGCGAGGGGGGG - Intergenic
1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG + Intergenic
1061285555 9:129620445-129620467 GAGCCGCTCGGAGCGCGGGCGGG + Exonic
1062230627 9:135479877-135479899 GGGGCGCGGGGAGGGGGCGCAGG - Exonic
1062435758 9:136545989-136546011 GGGGCGCGGGGCGCGGGCGCGGG - Intergenic
1062499653 9:136846911-136846933 TGGCTGCGTGGCGCGGGCGCGGG - Exonic
1062646809 9:137551943-137551965 GGGCCGCTTGGAGCTCGTGTGGG + Exonic
1188811403 X:34657293-34657315 GAGCCGGGAGGAGCGGGCGCGGG - Intergenic
1189821302 X:44872682-44872704 GGGACCCCTGGAGCGCGCGCGGG + Intergenic
1197078993 X:122389198-122389220 GGGCTGCGTGCAGCGCTCGTGGG - Intergenic
1197745975 X:129932411-129932433 GGGCCGCGGGGCGCGGCCGCGGG - Intergenic
1198388036 X:136147384-136147406 GGGCGGGGCGGGGCGCGCGCGGG - Exonic
1200145845 X:153926295-153926317 GGGCTGGGCGGAGCCCGCGCAGG - Intronic
1201715768 Y:17043129-17043151 GGGCTGCGTGCAGCGCTTGCGGG + Intergenic