ID: 1073299090

View in Genome Browser
Species Human (GRCh38)
Location 10:102459909-102459931
Sequence TAGCCGACAACCATCAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073299089_1073299090 -8 Left 1073299089 10:102459894-102459916 CCTGTTGCAGGAAGTTAGCCGAC No data
Right 1073299090 10:102459909-102459931 TAGCCGACAACCATCAATGAAGG No data
1073299085_1073299090 27 Left 1073299085 10:102459859-102459881 CCATTTGCTGTGGTTGTTAGGAG No data
Right 1073299090 10:102459909-102459931 TAGCCGACAACCATCAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073299090 Original CRISPR TAGCCGACAACCATCAATGA AGG Intergenic
No off target data available for this crispr