ID: 1073300345

View in Genome Browser
Species Human (GRCh38)
Location 10:102467541-102467563
Sequence ATTTTCTTCAGGGGGTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073300339_1073300345 10 Left 1073300339 10:102467508-102467530 CCTGAATAAAGCTTTGAGGAAAA 0: 1
1: 0
2: 1
3: 31
4: 382
Right 1073300345 10:102467541-102467563 ATTTTCTTCAGGGGGTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073300345 Original CRISPR ATTTTCTTCAGGGGGTTCAA GGG Intronic
No off target data available for this crispr