ID: 1073301490

View in Genome Browser
Species Human (GRCh38)
Location 10:102473704-102473726
Sequence CACAGCAGGCTGAGGTGGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 914
Summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 834}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073301490_1073301494 -7 Left 1073301490 10:102473704-102473726 CCGGACCACCTCAGCCTGCTGTG 0: 1
1: 0
2: 4
3: 75
4: 834
Right 1073301494 10:102473720-102473742 TGCTGTGCCTCTTCATTGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073301490 Original CRISPR CACAGCAGGCTGAGGTGGTC CGG (reversed) Exonic
900191546 1:1354303-1354325 CCCAGGAGACTGAGGTGGGCGGG - Intronic
901006129 1:6172431-6172453 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
901046107 1:6396674-6396696 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
901312086 1:8277373-8277395 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
901441165 1:9279348-9279370 CACAGGAGACTGAGGTGGGAGGG + Intergenic
901559227 1:10056919-10056941 CTCAGGAGGCTGAGGTGGGCTGG - Intronic
901834435 1:11914864-11914886 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
902225946 1:14996549-14996571 CACTGCAGGCAGGTGTGGTCAGG - Intronic
902262945 1:15240521-15240543 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
902492478 1:16794591-16794613 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
902567180 1:17319459-17319481 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
902591170 1:17475793-17475815 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
902627974 1:17687964-17687986 CACAGCAGCCTGGGGCGCTCAGG + Intronic
902738116 1:18414592-18414614 CACTGCATTCTGATGTGGTCTGG + Intergenic
902994933 1:20217056-20217078 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
903048783 1:20585591-20585613 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
903067241 1:20706986-20707008 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
903437082 1:23358321-23358343 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
903448072 1:23435133-23435155 CTCAGAAGGCTGAGGTGGGAGGG - Intronic
903505278 1:23829900-23829922 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
903893040 1:26582937-26582959 CACAGCGGGCGGGGGTGGTGGGG - Intergenic
904068241 1:27772149-27772171 CAAAGCAGGCTGGGGTGGGGTGG + Intergenic
904296619 1:29523520-29523542 CACAGCAGGAAGAGGTGGGCTGG - Intergenic
904437376 1:30507516-30507538 CACCCCAGGCTGGGGTGGCCAGG - Intergenic
904463515 1:30694290-30694312 CACAGCAGGAAGGGGTGGGCTGG + Intergenic
905078206 1:35293106-35293128 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
905229166 1:36502694-36502716 CTCAGGAGGCTGAGGTGGAAGGG - Intergenic
905231469 1:36517170-36517192 CACAGCAGAATGGAGTGGTCAGG - Intergenic
905393838 1:37654751-37654773 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
905398640 1:37685315-37685337 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
905640903 1:39589137-39589159 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
905719505 1:40185132-40185154 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
905766593 1:40606909-40606931 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
905832789 1:41086660-41086682 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
905861228 1:41353337-41353359 CTCAGAAGGCTGAGGTGGGCCGG - Intergenic
905934658 1:41813849-41813871 CACAACAGGCTGTGCTGGTCTGG - Intronic
906182052 1:43830138-43830160 CTCAGGAGGCTGAGGTTGTAAGG - Intronic
906408730 1:45562447-45562469 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
906453743 1:45975558-45975580 CTCAGTAGGCTGAGGTGGGAGGG + Intronic
906494454 1:46294213-46294235 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
906868253 1:49447044-49447066 CACTGGAGGCTGAGGTAGACAGG - Intronic
907256317 1:53181700-53181722 CGCAGGAGGCTGAGGTGGGAGGG + Intergenic
907286167 1:53381284-53381306 CTCAGGAGGCTGAGGTGGAAGGG - Intergenic
907361134 1:53916075-53916097 CCCAGGAGGCTGAGGTGGGAGGG + Intergenic
908022902 1:59916623-59916645 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
908436999 1:64116821-64116843 CACCGTAGGCTGGGGTGGTCAGG - Intronic
908455527 1:64300697-64300719 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
908540120 1:65114205-65114227 CACAGGAGGCTGAGGTGGGAAGG + Intergenic
909501031 1:76336096-76336118 CACAGCAGGCTGAGAGGGCTGGG + Intronic
910207761 1:84764915-84764937 CAGACAAGGCTGAGATGGTCAGG - Intergenic
910229783 1:84974163-84974185 CACTGCAGGCTAAAGTGCTCTGG + Intronic
911324936 1:96460050-96460072 CTCAGGAGGCTGAGGTGGGGGGG + Intergenic
911942826 1:104069324-104069346 CACTGCAGGCTGAAGGGTTCTGG - Intergenic
912378205 1:109230063-109230085 CACTGCAGGCTGGGGTGTGCAGG + Intronic
912500957 1:110121584-110121606 AGCAGCAGCCTGAGGTTGTCTGG - Intergenic
912643840 1:111372420-111372442 CACCACAGGCTGAAGTGCTCTGG + Intergenic
912900389 1:113641241-113641263 GAATGCAGGCTGAGGTGATCAGG + Intronic
913353733 1:117894233-117894255 CACAGGAGGCTGAGGAGCCCAGG - Intronic
913657448 1:120974883-120974905 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914008797 1:143757965-143757987 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914080855 1:144410410-144410432 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914175769 1:145278942-145278964 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914316510 1:146517830-146517852 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
914391473 1:147226938-147226960 CTCAGAAGGCTGAGGTGGGAGGG - Intronic
914497846 1:148215531-148215553 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
914647427 1:149666618-149666640 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914754550 1:150555287-150555309 CAGCACAAGCTGAGGTGGTCAGG - Intronic
914807270 1:151000884-151000906 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
915273523 1:154772502-154772524 AAGAGCATGCTGAGGTGGTCAGG - Intronic
915381152 1:155441871-155441893 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
916862050 1:168816462-168816484 CTCAGAAGGCTGAGGTGGGAGGG + Intergenic
917106642 1:171498907-171498929 CTCAGGAGGCTGAGGTGGAAGGG - Intronic
917343783 1:174007569-174007591 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
917402685 1:174668266-174668288 CACCAGAGGCTGTGGTGGTCAGG - Intronic
917616873 1:176754897-176754919 CACTGCAGGCAGAGGAAGTCTGG + Intronic
918326004 1:183411409-183411431 CTCAGGAGGCTGAGGTGGGACGG - Intronic
918997065 1:191775162-191775184 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
919147308 1:193651758-193651780 CACTGCAGACTGAAGTGTTCTGG - Intergenic
919170942 1:193953257-193953279 AACTTCAGGCTGGGGTGGTCAGG - Intergenic
919714917 1:200766249-200766271 CCCAGGAGGCTGAGGTGGGAGGG - Intronic
919740531 1:200978792-200978814 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
920098761 1:203503449-203503471 CAGAGCAGGCAGAGCTGGTAGGG + Intronic
920119055 1:203642048-203642070 CACAGTAGGCTGTGGGGGTTAGG - Intronic
920422824 1:205847123-205847145 TACAGGAGGCTGAGGTGGGAGGG - Intronic
920423632 1:205854614-205854636 TACAGGAGGCTGAGGTGGGAGGG + Intergenic
920579434 1:207091561-207091583 CACTGAAGACTGAGGAGGTCTGG + Intronic
920624479 1:207583181-207583203 CACAGGAGGGTGAGGTGCCCTGG + Intronic
921397254 1:214681717-214681739 CTCAGAAGGCTGAGGTGGGAGGG + Intergenic
922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG + Intronic
922976496 1:229788531-229788553 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
922999372 1:229994106-229994128 CACGCCAGGCTGATGTGTTCAGG - Intergenic
923123076 1:231012313-231012335 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
923527970 1:234787941-234787963 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
923665671 1:235996547-235996569 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
923774217 1:236964076-236964098 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
923876600 1:238056181-238056203 CTCAGGAGGCTGAGGAGGTAGGG - Intergenic
923908204 1:238409447-238409469 CACAGAAGGCTCAGGAGGTTAGG - Intergenic
924094273 1:240534935-240534957 CACAGCAGGACGAGTGGGTCTGG + Intronic
924227416 1:241933415-241933437 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
924257487 1:242197004-242197026 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
924295785 1:242585835-242585857 CAAACCAGGCGGTGGTGGTCAGG - Intergenic
924446128 1:244133263-244133285 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
924494005 1:244568711-244568733 CACAGCAGTCTGAAGTGACCTGG - Intronic
1063997011 10:11629042-11629064 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1064059827 10:12128592-12128614 CTCGGGAGGCTGAGGTGGGCAGG + Intergenic
1064328381 10:14372105-14372127 CACAGGATGGTGAGGTAGTCTGG + Intronic
1064376445 10:14800859-14800881 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1064377057 10:14806321-14806343 CCCAGGAGGCAGAGGTTGTCAGG + Intergenic
1064520838 10:16199004-16199026 CTCAGGAGGCTGAGGTGGGCAGG + Intergenic
1065211198 10:23405122-23405144 CTCAGGAGGCTGAGGTGGGGGGG - Intergenic
1065339166 10:24687106-24687128 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1065842527 10:29714850-29714872 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1065961208 10:30735684-30735706 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1065984219 10:30933508-30933530 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1066317474 10:34262372-34262394 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1066372112 10:34825922-34825944 CTCAGGAGGCTGAGATGGGCGGG + Intergenic
1067080160 10:43208269-43208291 CACTGCAGGCTGCTCTGGTCAGG + Intronic
1067088060 10:43253195-43253217 CACATCAGGATGAGGTGGTGGGG - Intronic
1067097753 10:43313767-43313789 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1067247997 10:44562283-44562305 AACAGCAGAATAAGGTGGTCGGG - Intergenic
1068222795 10:54064640-54064662 CACAGGAGGCTGAGGTGGCAGGG + Intronic
1068545427 10:58339211-58339233 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1069489764 10:68851193-68851215 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1069601589 10:69711441-69711463 CATAGCACACTGTGGTGGTCAGG + Intergenic
1069623813 10:69854463-69854485 CTCGGGAGGCTGAGGTGGTAGGG + Intronic
1069861616 10:71475262-71475284 CCCAGCAGGCTGGAGAGGTCAGG - Intronic
1070074564 10:73122677-73122699 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1070085050 10:73228971-73228993 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1070098438 10:73361398-73361420 CACGGGAGGCTGAGGTGGGAGGG - Intergenic
1070173568 10:73951386-73951408 CTCAGAAGGCTGAGGTGGGAGGG + Intergenic
1070818249 10:79338920-79338942 CACAGAAGGCTGAGGGGACCAGG - Intergenic
1071298436 10:84239335-84239357 CTCAGAAGGCTGAGGTGGGAAGG + Intronic
1071545987 10:86529915-86529937 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1071962573 10:90821506-90821528 CACTGCAGGCTAAGGTGCTCTGG + Intronic
1072375692 10:94813655-94813677 CACAGCAGTCTGAAGTTGACTGG - Intronic
1072389568 10:94969307-94969329 CACAGCAGTCTGAAGTTGACTGG - Intronic
1072619586 10:97070925-97070947 CTCAGAAGGCTGAGGTGGGGAGG - Intronic
1072641993 10:97218570-97218592 CCCAGGAGGCTGAGGTGGAAGGG - Intronic
1072971978 10:100025257-100025279 CTCAGAAGGCTGAGGTGGGAGGG + Intergenic
1073145092 10:101275382-101275404 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1073236488 10:102021182-102021204 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1073301490 10:102473704-102473726 CACAGCAGGCTGAGGTGGTCCGG - Exonic
1073469419 10:103713640-103713662 ACCAGCCTGCTGAGGTGGTCAGG - Intronic
1074440955 10:113477012-113477034 CCCAGAAGGCTGAGGGGGCCCGG - Intergenic
1074812989 10:117124101-117124123 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1075076476 10:119354507-119354529 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1075418962 10:122286818-122286840 GAGAGGAGGCTGGGGTGGTCAGG - Intronic
1075421965 10:122308572-122308594 CACAGCAGGCTCTGGCTGTCTGG - Intronic
1075496291 10:122922343-122922365 CACTGCAGGCTAAAGTGCTCTGG + Intergenic
1076776665 10:132701649-132701671 CACCTCAGGCTGGGGTGCTCAGG + Intronic
1076891198 10:133284468-133284490 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1077412968 11:2412007-2412029 CTCAGGAGGCTGAGGTGGGTGGG - Intronic
1078100574 11:8328224-8328246 CAGAGAAGGCTGAGCTGGACAGG + Intergenic
1078682216 11:13487435-13487457 CTCAGAAGGCTGAGCTGGTGGGG + Intergenic
1079001271 11:16758870-16758892 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1079934724 11:26602642-26602664 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1080660782 11:34294220-34294242 CTCAGGAGGCTGAGGTGGGATGG + Intronic
1081632024 11:44695709-44695731 GGCAGCAGGCTGGGGTGGACAGG + Intergenic
1081710504 11:45212730-45212752 CCCAGCAGACCGAGGTGTTCCGG + Intronic
1081922368 11:46790752-46790774 CACAGTAGGCTGAGGTGGGAAGG - Intronic
1082099033 11:48156692-48156714 CACAGGAGGCTGAAGTGGGAGGG - Intronic
1082810595 11:57476897-57476919 CACCGCAGTCAGAGGTGGTGGGG - Exonic
1083614408 11:64019179-64019201 CACTGCAGGCCGAGGTGGCCCGG + Intronic
1083809315 11:65094701-65094723 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1083996357 11:66274948-66274970 CACCTCAAGCAGAGGTGGTCTGG + Intronic
1084606340 11:70174586-70174608 CACAACAGGCTGAGGTTCTGAGG - Intronic
1084645095 11:70452037-70452059 CTCAAGAGGCTGAGGTGGCCGGG - Intergenic
1084666595 11:70579651-70579673 CACAGCAGGCTGACCTGCACAGG - Intronic
1084770564 11:71340418-71340440 CACAGCAGGCAGTGGGTGTCAGG + Intergenic
1084884266 11:72193227-72193249 CTCAGGAGGCTGAGGTGGGCAGG + Intronic
1085062332 11:73459189-73459211 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1085469344 11:76747141-76747163 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1085633683 11:78141108-78141130 CTCAGGAGGCTGAGGTGGGGAGG - Intergenic
1086081481 11:82907645-82907667 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1086103451 11:83125803-83125825 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1086240922 11:84690088-84690110 TACCAGAGGCTGAGGTGGTCGGG + Intronic
1086384430 11:86292682-86292704 CTCAGAAGGCTGAGGTGGGAGGG - Intergenic
1086847893 11:91774238-91774260 CACCACAGGCTGAAGTGCTCTGG - Intergenic
1088482989 11:110313608-110313630 CTCAAGAGGCTGAGGTGGGCCGG + Intergenic
1088810534 11:113388572-113388594 CAGTGCAGGCTGAGGAGGTCAGG + Intronic
1088970824 11:114773336-114773358 CACAGCTGTTTGAGTTGGTCTGG - Intergenic
1089546229 11:119228213-119228235 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1090240930 11:125181359-125181381 CACTGCAGGCTGGAGTAGTCTGG + Intronic
1090287265 11:125510778-125510800 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1090485977 11:127112423-127112445 CACAGCATGCTGTGGTGGAAGGG + Intergenic
1090828467 11:130404500-130404522 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1090839856 11:130478249-130478271 CCCAGCAGGCTGAGCTGGCGTGG + Intergenic
1091310489 11:134572005-134572027 GACAGCTGGCTGAGCAGGTCAGG + Intergenic
1091755050 12:3045847-3045869 AACAGCAGGGAGAGGTGGTCAGG + Intergenic
1093767188 12:22978510-22978532 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1093991002 12:25590419-25590441 CACTGCAGGCTAAAGTGCTCTGG + Intronic
1094059397 12:26297509-26297531 CACATCAGGCTAGAGTGGTCAGG - Intronic
1094111253 12:26865185-26865207 CCCAGGAGGCTGAGGTGGGAGGG - Intergenic
1094116936 12:26926468-26926490 CGAAGCAGGCTGAAGTGTTCAGG - Intronic
1094172633 12:27509736-27509758 CACAGGAGGCTGAGGTGGGAGGG - Intergenic
1094497409 12:30997086-30997108 CACAGTAGAGTGAGTTGGTCTGG - Intergenic
1096164942 12:49414708-49414730 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1096190824 12:49617434-49617456 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1096253693 12:50050527-50050549 CACAGGAGGCTCAGCTTGTCGGG - Intergenic
1096857545 12:54495610-54495632 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
1096988641 12:55780038-55780060 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1097017544 12:55998037-55998059 CAGAGAAGATTGAGGTGGTCCGG + Intronic
1097063875 12:56306004-56306026 CCCAGGAGGCTGAGGTGGGAGGG - Intronic
1097142751 12:56916495-56916517 CTCAGGAGGCTGAGGTGGGCGGG - Intergenic
1097152006 12:56986039-56986061 CACAGAGGGCTGAGGTAGGCAGG + Intergenic
1097235588 12:57537224-57537246 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
1097235838 12:57538882-57538904 GAGAGAAGGCTGAGGTGGTGGGG + Intronic
1097797160 12:63875021-63875043 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1097868102 12:64576741-64576763 CCCAGGAGGCTGAGGTGGGATGG + Intergenic
1098529761 12:71528348-71528370 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1100101173 12:91107554-91107576 CACAGCAGGATGAGTTGGCCCGG + Intronic
1100836954 12:98575473-98575495 CTCAGGAGGCTGAGGTGGGGAGG - Intergenic
1100946325 12:99787995-99788017 CACTGCAGGCTGAAGTGCTCTGG + Intronic
1101027306 12:100623731-100623753 TTCAGGAGGCTGAGGTGTTCTGG - Exonic
1101039529 12:100740318-100740340 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1101466078 12:104950610-104950632 CTCAGGAGACTGAGGTGGTAGGG - Intronic
1101685463 12:107015449-107015471 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1101928432 12:108992431-108992453 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1101977636 12:109375258-109375280 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1102102669 12:110292677-110292699 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1102322455 12:111948986-111949008 CTCAGGAGGCTGAGGTGGTGGGG + Intronic
1102485936 12:113256775-113256797 CACATCAGGCTAAGGTGGGGAGG - Intronic
1102489047 12:113277786-113277808 CACAGCAGGCTGCTGTGGACAGG - Intronic
1102768484 12:115452845-115452867 CACAGGATGCTGAGATGGGCAGG - Intergenic
1102899721 12:116626894-116626916 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
1103349521 12:120274152-120274174 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1103544535 12:121690541-121690563 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1103755105 12:123198700-123198722 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1104974847 12:132547853-132547875 ACCAGCAGGCCCAGGTGGTCGGG - Intronic
1104988989 12:132614196-132614218 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1105504099 13:20995358-20995380 CACAGCAGCCTGAGGTAAGCTGG - Intronic
1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG + Intergenic
1106177856 13:27346672-27346694 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1106449728 13:29869373-29869395 CTCAGGAGGCTGAGGTGGTTGGG + Intergenic
1106507795 13:30386695-30386717 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1106895908 13:34302255-34302277 CACTCCAGTCTGAGGTGGCCAGG - Intergenic
1107111192 13:36699919-36699941 CTCACCAGGCATAGGTGGTCAGG + Intergenic
1107349868 13:39502511-39502533 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
1107512944 13:41103234-41103256 TACAGGAGGCTGAGGTGGGAGGG + Intergenic
1107945777 13:45416661-45416683 CTCCGCAGGCTGAGGTGGAAGGG + Intronic
1108030677 13:46226089-46226111 CTCAGAAGGCTGAGGTGGGAGGG - Intronic
1108322674 13:49303179-49303201 CACAGGAGGGTGAGGTTGCCTGG + Intergenic
1108350711 13:49588525-49588547 CTCAGGAGGCTGAGGTGCTGAGG - Intergenic
1109212604 13:59551159-59551181 TTCAGGAGGCTGAGGTGGGCAGG + Intergenic
1109588796 13:64447521-64447543 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1109645156 13:65244557-65244579 CCCAGGAGGCTGAGGTGGGAGGG - Intergenic
1111020067 13:82437724-82437746 AAGTCCAGGCTGAGGTGGTCTGG + Intergenic
1111590202 13:90336779-90336801 CACAGAATACTGAGGTGATCAGG + Intergenic
1112507715 13:99985170-99985192 CCAGGCCGGCTGAGGTGGTCCGG - Intronic
1112953595 13:105032949-105032971 CACAGAAGTATGAGGTGGTGAGG + Intergenic
1113040888 13:106102681-106102703 CATAGCTGGCTGATATGGTCTGG - Intergenic
1113353934 13:109559671-109559693 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1113494783 13:110718306-110718328 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1114232483 14:20796375-20796397 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
1114244978 14:20904677-20904699 CAAAGCAGGCTAAAGTGCTCTGG + Intergenic
1114247986 14:20932849-20932871 CACAGTAGGCTAAAGTGCTCTGG + Intergenic
1114250819 14:20958948-20958970 CACAGTAGGCTAAAGTGCTCTGG + Intergenic
1114678787 14:24465266-24465288 CTCAGAAGGCTGAGGTGGGAGGG - Intergenic
1115159446 14:30376992-30377014 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1115247401 14:31310275-31310297 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1115265367 14:31494682-31494704 CACAGCAGTCTGAAGTTGACCGG + Intronic
1115374036 14:32652943-32652965 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1115591738 14:34872481-34872503 CTCAGGAGGCTAAGGTGGTAAGG + Intronic
1116167411 14:41350753-41350775 CCCAGCAGGTTGAGGTTGACTGG - Intergenic
1116879345 14:50148993-50149015 CCCAGGAGGCTGAGGTGGGAAGG - Intronic
1117129736 14:52673843-52673865 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1117161589 14:52995165-52995187 CGCAGCAGGCTAATGTGCTCTGG - Intergenic
1117371092 14:55078984-55079006 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1117384346 14:55195633-55195655 CACAGCAGGCTGAAGTGCTCTGG - Intergenic
1117995987 14:61478750-61478772 CACAGGAGGCTGAGGTTGGAAGG + Intronic
1118096828 14:62546555-62546577 CACTGCAGGCTAAAGTGGTCTGG + Intergenic
1118267417 14:64308120-64308142 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1118578137 14:67265446-67265468 CACAGGAGGCTGAGGTGGGAGGG + Intronic
1118861235 14:69665354-69665376 CTCAGGAGGCTAAGGTGGTGAGG - Intronic
1119275397 14:73350637-73350659 CACAGGAGGCTGAGGTGGGAAGG - Intronic
1119424974 14:74529133-74529155 CACAGCACGTGGAGGTGGGCAGG + Intronic
1119605243 14:76010159-76010181 CACAGGAGGCTAGGGTGGGCAGG + Intronic
1119706049 14:76783181-76783203 TTCAGCAGGCTGAGGAAGTCTGG - Intergenic
1119927715 14:78512155-78512177 CAAAGTCGGCTGAGGTGGTGTGG - Intronic
1121051328 14:90820675-90820697 TACAGCAGGGTGAGGGGGTAAGG - Intergenic
1121120259 14:91371917-91371939 CCCAGCAGGCTGGGGTGGTCTGG - Intronic
1121218497 14:92266942-92266964 CTCGGGAGGCTGAGGTGGTGGGG - Intergenic
1121937305 14:98031837-98031859 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1122216773 14:100209723-100209745 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1122556858 14:102585249-102585271 GACAGGGGGCTGAGGCGGTCAGG + Intergenic
1122598614 14:102909743-102909765 TGGAGCAGGCTGACGTGGTCTGG - Exonic
1122886247 14:104711718-104711740 CCCACCTGGCTGAGGTGGGCGGG - Intronic
1123539109 15:21269863-21269885 CACAGGAGGCTGAGGTGGGAGGG - Intergenic
1123819984 15:24019101-24019123 CACAGGAGACTGAGGTGGGAGGG - Intergenic
1124933620 15:34148478-34148500 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1125493887 15:40171437-40171459 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1125867974 15:43071987-43072009 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1125897041 15:43311177-43311199 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1126067143 15:44834740-44834762 CTCAGAAGGCTGAGGTGGGAGGG - Intergenic
1127082274 15:55392626-55392648 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1127155855 15:56123694-56123716 CACTGCAGGCTAAAGTGCTCTGG - Intronic
1127186979 15:56490382-56490404 CTCAGGAGGCTGAGGTGGAAGGG + Intergenic
1127372019 15:58350345-58350367 CACTGCGGGCTGAGGTGGAGGGG - Intronic
1127861411 15:62997206-62997228 CACAGGAGGCTGAGGTGGGAGGG + Intergenic
1128322694 15:66704045-66704067 CAGAGCCGGCTGAAGTGGTAGGG - Exonic
1128802822 15:70507697-70507719 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1128886659 15:71294378-71294400 CCAAGCAGGCTGAGTTGGACGGG + Intronic
1129099880 15:73251403-73251425 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1129252471 15:74316476-74316498 CACAGCAGGCAGGGGAGGACAGG + Intronic
1129388517 15:75208776-75208798 CACTGCAGGCCGAGAAGGTCGGG - Exonic
1129392576 15:75227864-75227886 CCCAGGAGGCTGTGGTGGTGGGG + Intergenic
1129471820 15:75760332-75760354 CCCAGGAGGCTGTGGTGGTGGGG - Intergenic
1129674387 15:77624696-77624718 CACAGCAGGGTGGGGTGCACTGG - Intronic
1129786253 15:78312145-78312167 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1130308976 15:82736060-82736082 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1130377561 15:83343100-83343122 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1131183956 15:90259280-90259302 CTCAGGAGGCTGAGGTGGGATGG + Intronic
1131223516 15:90605142-90605164 CTCAGGAGGCTGAGGTGGGGAGG + Intronic
1131240927 15:90742741-90742763 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1132281343 15:100618594-100618616 CACAGCAGGGTGAGAAGGTGAGG - Intronic
1132427137 15:101727310-101727332 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1132471882 16:109074-109096 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1132807973 16:1784196-1784218 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1132948864 16:2549025-2549047 CTCAGGAGGCTGAGGTGGGGGGG - Intronic
1132965723 16:2653102-2653124 CTCAGGAGGCTGAGGTGGGGGGG + Intergenic
1133103012 16:3490472-3490494 CTCAGGAGGCTGAGATGGTAGGG + Intergenic
1133447282 16:5872626-5872648 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1133539325 16:6733648-6733670 CTCAGGAGGCTGAGATGGGCAGG + Intronic
1133932939 16:10247088-10247110 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1134049551 16:11127760-11127782 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1134133825 16:11667335-11667357 CTCACGAGGCTGAGGTGGCCAGG - Intergenic
1134171174 16:11970959-11970981 CACAGGAGCCTGAGGTGGGAGGG - Intronic
1134173129 16:11984762-11984784 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1134472108 16:14534109-14534131 CTCAGAAGGCTGAGGTGGGAGGG + Intronic
1134621962 16:15696265-15696287 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1134635961 16:15792164-15792186 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1135088769 16:19495602-19495624 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1135202502 16:20450642-20450664 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
1135207097 16:20492850-20492872 CACAGGGTGCTGAGGTGGTAGGG - Intergenic
1135211788 16:20530782-20530804 CACAGGGTGCTGAGGTGGTAGGG + Intergenic
1135216602 16:20577224-20577246 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
1135344363 16:21676033-21676055 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1135629668 16:24026185-24026207 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
1135661864 16:24303808-24303830 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1135755788 16:25096806-25096828 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1135927470 16:26708182-26708204 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1136137254 16:28264019-28264041 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1136186035 16:28589520-28589542 TAATGCAGGCTGAGGGGGTCTGG - Intronic
1136242931 16:28955704-28955726 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1136389269 16:29952103-29952125 CACTGCAGGCTAAAGTGCTCTGG - Intronic
1136457904 16:30392392-30392414 CTCGGGAGGCTGAGGTGGGCAGG - Intronic
1136543664 16:30943295-30943317 CTCAGGAGGCTGAGGTGGGGAGG - Intronic
1137514317 16:49129903-49129925 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1137728726 16:50674355-50674377 CTCAGGAGGCTCAGGTGGGCAGG - Intronic
1138188888 16:54998219-54998241 CCCAGGAGCCTGAGGTGGGCAGG - Intergenic
1138218298 16:55225011-55225033 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1138229270 16:55325424-55325446 TACAGAAGTCTGAGGTGGCCGGG + Intronic
1138686360 16:58729417-58729439 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1138831518 16:60380633-60380655 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1139018919 16:62724496-62724518 CACAGGAGGCTGAGGTAGGAGGG + Intergenic
1139549451 16:67665467-67665489 CTCGGCAGGCTGAGGTAGCCGGG - Intronic
1139633325 16:68243757-68243779 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1139779357 16:69338182-69338204 CACAGGAGGTTGAGGTGGGGGGG - Intronic
1140713692 16:77702280-77702302 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1140904106 16:79395822-79395844 AACAGTAGGGAGAGGTGGTCTGG + Intergenic
1141450335 16:84095618-84095640 CACTGCAGGCAGATGTGCTCTGG - Exonic
1141807903 16:86354125-86354147 CACAGCAGCCTGGTGTGGTTTGG + Intergenic
1141964001 16:87429179-87429201 CACCGCAGCCTGAGGTGGGTGGG + Intronic
1142481162 17:219033-219055 CACAGCAGGGTGAGGAGGGCAGG - Intronic
1142486952 17:253640-253662 GACAGCAGACTGGGGTGGCCAGG - Intronic
1142556647 17:782679-782701 GACAGGAGGCTGAGGTGATGTGG + Exonic
1142840047 17:2621727-2621749 CTCAGAAGGCTGAGGTGGGAGGG - Intronic
1143309830 17:5979012-5979034 AACACCAGGCTGGGGTGGACAGG + Intronic
1143413612 17:6728605-6728627 CACTGCAGGCTGAAGTGCTCTGG + Intergenic
1143774308 17:9187721-9187743 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1143879195 17:10016840-10016862 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1144007775 17:11116675-11116697 CCCAGGAGGCTGAGGTGGGCAGG - Intergenic
1144309019 17:13995216-13995238 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1145770104 17:27486699-27486721 CACTGCAGTCTCAGGTGGGCAGG - Intronic
1146494940 17:33313216-33313238 CTCAGGAGGCTGAGGTGGGCAGG + Intronic
1147138540 17:38448924-38448946 CTCAGGAGGCTGAGGTGGGGAGG - Intronic
1147538458 17:41335719-41335741 CACAGCAGGGAGGGGTGGGCAGG + Intergenic
1147630567 17:41928029-41928051 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1147649739 17:42055104-42055126 GACAGGATGCTGAGGGGGTCGGG - Intronic
1147697068 17:42363549-42363571 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1147756222 17:42770000-42770022 CACAGGAGGCTGAGGTTGCAGGG - Intergenic
1147777922 17:42916468-42916490 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1147992313 17:44342157-44342179 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1148103033 17:45104309-45104331 TACAGCAGGCTGGGCTGGGCTGG - Intronic
1148180909 17:45604096-45604118 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1148245389 17:46026750-46026772 GTCAGCGGGCTGAGGTGCTCTGG - Exonic
1148267998 17:46241820-46241842 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1148372668 17:47112418-47112440 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1148625118 17:49063245-49063267 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
1148761621 17:50005364-50005386 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1149125128 17:53220517-53220539 CCCAGGAGGCTGAGGTGGGAGGG + Intergenic
1149249319 17:54749856-54749878 TATAGCAGGCTAAGGTGCTCTGG - Intergenic
1149897554 17:60440762-60440784 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1151173959 17:72271551-72271573 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1151421632 17:74002126-74002148 CCCAGGAGGCTGAGGTGGGAGGG - Intergenic
1151718548 17:75843558-75843580 CAGAGCAGGCTCAGATGGACAGG + Intronic
1151751793 17:76043154-76043176 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1151840157 17:76611889-76611911 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1151883336 17:76908372-76908394 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1152260869 17:79266382-79266404 CACAGCTGGATGAGATGGGCGGG - Intronic
1152497647 17:80685381-80685403 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1152580046 17:81161893-81161915 CAGAGCTGGCTGGGGTGGGCTGG - Intronic
1153678010 18:7472765-7472787 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1153680435 18:7495520-7495542 CTCAGGAGGCTGAGGTGGTAGGG - Intergenic
1153955597 18:10093093-10093115 CACTGCAGGCTGAAGAGGTGAGG + Intergenic
1154008492 18:10555971-10555993 CACAGCAGGCTGTGGGGTCCAGG + Intergenic
1155087955 18:22475859-22475881 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1155268441 18:24116433-24116455 CTCAGCAGGCTGAGGCGGGCGGG + Intronic
1155425523 18:25702590-25702612 CTCAGGAGGCTGAGGTGGAAGGG + Intergenic
1155485168 18:26333495-26333517 CTCAGCAAGCTGAGGTGGGTGGG - Intronic
1155493485 18:26421681-26421703 CAGAAAAGCCTGAGGTGGTCAGG + Intergenic
1155929737 18:31693858-31693880 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1156351012 18:36300846-36300868 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1156463733 18:37335889-37335911 CACAGCAGGCTGCGGGTGTCAGG - Intronic
1157096143 18:44687103-44687125 CAGAGAAGGCTGAGGAGGCCGGG + Intronic
1157271623 18:46280674-46280696 TTCAGGAGGCTGAGGTGGTGGGG - Intergenic
1157813781 18:50716773-50716795 CAGGGCAGGCTGAGGAGGTGGGG - Intronic
1157973420 18:52297798-52297820 CTCAGGAGGCTGAGGTGGAAGGG + Intergenic
1158030896 18:52963515-52963537 CACAGGAGTCTGAAGTGGTCAGG + Intronic
1159986005 18:74841457-74841479 CAGAGCAGGGTGAGGAGGTTTGG - Intronic
1160226160 18:77012713-77012735 CACAGCACACTGACGTGGTGGGG + Intronic
1160504430 18:79419129-79419151 CTCGGCAGGCTGAGGTGGGAGGG - Intronic
1160530866 18:79561687-79561709 AACGGCAGGCTGACGTGGTGTGG - Intergenic
1160761514 19:787753-787775 CACAGCCGGCTCGGGTGGCCTGG - Intergenic
1161093970 19:2377980-2378002 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1161164853 19:2780976-2780998 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1161572007 19:5035904-5035926 CACAGGAGACTGAGGTGGGGAGG + Intronic
1161638328 19:5403385-5403407 TGAAGCAGGCTGATGTGGTCAGG + Intergenic
1161804559 19:6435114-6435136 CACAGGAGGCTGAGGTGGGAGGG + Intergenic
1161884777 19:6986005-6986027 CACGGAAGGCTGATGTGGTTGGG - Intergenic
1161974669 19:7601633-7601655 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1162245187 19:9394091-9394113 TTCAGGAGGCTGAGGTGGGCAGG + Intergenic
1162460955 19:10813716-10813738 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1162559990 19:11411501-11411523 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1163090838 19:15019054-15019076 CTCAGGAGGCTGAGGTGGGGGGG - Intronic
1164508392 19:28877948-28877970 CTGTGCAGGTTGAGGTGGTCAGG - Intergenic
1164860912 19:31561578-31561600 CTCGGGAGGCTGAGGTGGGCGGG - Intergenic
1164936243 19:32216790-32216812 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165641532 19:37392495-37392517 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1165682177 19:37787213-37787235 CTCAGGAGGCTGAGGTGGGGAGG - Intronic
1165684791 19:37810075-37810097 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1165775087 19:38399481-38399503 CAGTGCAGGCTGAAGTGGTGGGG + Intergenic
1165911455 19:39230939-39230961 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1165927205 19:39334373-39334395 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1166097335 19:40549133-40549155 CACAGCAGGATCAGGAGGGCGGG + Intronic
1166312058 19:41968566-41968588 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
1166685816 19:44795407-44795429 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1166704697 19:44902308-44902330 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1166723963 19:45014275-45014297 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1166759427 19:45215361-45215383 CTCAGAAGGCTGAGGTGGGAGGG + Intronic
1166798493 19:45442206-45442228 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
1167016559 19:46844690-46844712 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1167750772 19:51378979-51379001 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1168039012 19:53743216-53743238 CCCAGGAGGCTGAGGTTGTATGG - Intergenic
925269337 2:2591211-2591233 AACTGCAGGCTGAAGTGCTCTGG + Intergenic
925359581 2:3268121-3268143 ATCACCAGGCTGAGGTGGTGGGG - Intronic
925964204 2:9048154-9048176 CACAGCAGTCAGAGGAGGGCTGG + Intergenic
926972974 2:18485234-18485256 CAGACAAGGCTGAGGTGGACAGG - Intergenic
927141850 2:20136262-20136284 CCCTGCAGGCTGAGGCGGGCAGG + Intergenic
927609541 2:24524399-24524421 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
927749822 2:25657610-25657632 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
927773962 2:25887722-25887744 CACAGGAGTCTGAAGTGCTCAGG - Intergenic
928004169 2:27548498-27548520 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
928185468 2:29106357-29106379 CATTGCAGGATGGGGTGGTCAGG - Intronic
928640139 2:33289606-33289628 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
928949894 2:36805194-36805216 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
929893185 2:45936185-45936207 CACAGCAGGCAGGGGTGGGCAGG - Intronic
930239016 2:48916409-48916431 CACAGAAGGCCACGGTGGTCAGG + Intergenic
931432116 2:62216511-62216533 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
932081745 2:68722040-68722062 CACTGCATGCTGAGGTGCTGAGG - Intronic
932216519 2:69969724-69969746 CACAGGAGGCAGAGGGTGTCTGG - Intergenic
932484550 2:72075714-72075736 CTCAGCTGACTGAGGTGGTAAGG + Intergenic
933030803 2:77326499-77326521 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
933316417 2:80720668-80720690 CTCAGGAGGCTGAGGTGGTAGGG - Intergenic
933352227 2:81168644-81168666 CATAGAAGGCTGAGATGATCTGG + Intergenic
933767341 2:85719083-85719105 GACAGTGGGCTCAGGTGGTCGGG + Intergenic
934534182 2:95119502-95119524 CACAGGAGGCTGAAGTGGGAGGG + Intronic
934961202 2:98675653-98675675 CTCAGGAGGCTGAGGTGGGGAGG - Intronic
935033706 2:99347111-99347133 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
935229142 2:101080881-101080903 CTCAGGAGGCTGAGGTGGGACGG - Intronic
935764417 2:106351499-106351521 CACGGGAGGCTGAGGTGGGAGGG - Intergenic
936901433 2:117485614-117485636 CACTGCAGGCTAACGTGCTCTGG - Intergenic
936970180 2:118169485-118169507 CACTGCAGGCTGTGGAGCTCAGG + Intergenic
937273966 2:120672466-120672488 CTCAGGAGGCTGAGGTGGCATGG - Intergenic
937942619 2:127297806-127297828 CCCAGGAGGCTGAGGTGGGTGGG - Intergenic
937952911 2:127402005-127402027 GAAGGCAGGCTGAGGTGGGCAGG - Intergenic
938004127 2:127773869-127773891 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
938161458 2:128988145-128988167 CCCAGGAGGCTGAGGAGGTGCGG + Intergenic
938206174 2:129425903-129425925 CACAGGAGGCGGAGGTTGTAGGG - Intergenic
938714369 2:134006064-134006086 TTCAGGAGGCTGAGGTGGGCTGG - Intergenic
938844868 2:135197900-135197922 CACAGGAGGCTGAGGTAGGAGGG - Intronic
938907834 2:135855421-135855443 TTCAGGAGGCTGAGGTGGTAAGG + Intronic
940657213 2:156502532-156502554 CTCAGGAGGCTGAGGTGGTAGGG - Intronic
940807229 2:158201515-158201537 CTCAGGAGGCTGAGGTGGGACGG - Intronic
940875320 2:158892351-158892373 CTCAGAAGGCTGAGGTGGGAGGG - Intergenic
940878763 2:158924660-158924682 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
941068700 2:160932030-160932052 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
941173226 2:162164969-162164991 CACTGCAGGCTGAGGAAGTTTGG - Intergenic
941651162 2:168094084-168094106 CACAGCATGCTGGGGAGGGCTGG - Intronic
942082274 2:172411938-172411960 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
942247324 2:174019641-174019663 CTCAGGAGGCTGAGGTGGGGGGG + Intergenic
942737997 2:179138761-179138783 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
942749972 2:179276460-179276482 CACTGCAGGCTAAAGTGCTCTGG + Intergenic
943184289 2:184586707-184586729 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
943226464 2:185185188-185185210 AACAGCAGGCTGAGGTGGCGAGG - Intergenic
943592861 2:189820403-189820425 CTCAGGAGGCTGAGGTGGAAGGG - Intronic
944162568 2:196680407-196680429 CTCAGGAGGCTGAGGTGGGTGGG - Intronic
944194448 2:197037832-197037854 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
944528392 2:200643119-200643141 GACAGCTGGCTGAGATGTTCAGG - Intronic
945074813 2:206027594-206027616 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
945293042 2:208144509-208144531 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
945575580 2:211525068-211525090 CACTGCAAGCTGAAGTGTTCTGG + Intronic
945890066 2:215421201-215421223 CCCAGCATGATGTGGTGGTCTGG + Intronic
946838929 2:223800422-223800444 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
947586718 2:231361055-231361077 CACAGCCCTCCGAGGTGGTCAGG - Intronic
948017348 2:234701519-234701541 CACAGCTGGCAGAGGAGGTGAGG + Intergenic
948193054 2:236074943-236074965 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
948263880 2:236623770-236623792 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
948436982 2:237960577-237960599 CAAAGCAGCCGGAGGTGGTGTGG - Intergenic
948826869 2:240577237-240577259 CCCAGCAGGCTGTGGTGGCCTGG - Intronic
949079019 2:242081941-242081963 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1168770821 20:415258-415280 CCCAGGAGGCTGAGGTGGGAGGG + Intronic
1168998709 20:2151091-2151113 CACTGCAGGCTGAGGGGCTGTGG - Intronic
1169154355 20:3316826-3316848 CAAGGCAGGCTGAGCTGGTAGGG - Intronic
1169535726 20:6537913-6537935 CTCAGCAGGCTGAGGTTACCAGG - Intergenic
1169960920 20:11159358-11159380 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1170683817 20:18550715-18550737 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1170811971 20:19681155-19681177 CCCAGCAGGCTGAGGTGGGAAGG - Intronic
1171084502 20:22224995-22225017 CTCAGTAGGCTGAGGTGGGAGGG - Intergenic
1171491012 20:25517168-25517190 CACAGCAGGATGTCCTGGTCAGG - Intronic
1171848159 20:30290423-30290445 TACAGCAGGCTGTGGGGGTGGGG + Intergenic
1172241013 20:33412481-33412503 CAGGGCAGGGTGAGGTGGCCAGG + Intronic
1172244932 20:33439259-33439281 CTTAGAAGGCTGAGGTGGGCAGG + Intronic
1172466049 20:35155262-35155284 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1172484854 20:35291979-35292001 GAGAGCAGGCTGAGGCGGTCTGG + Exonic
1172494717 20:35371906-35371928 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1173004276 20:39127539-39127561 CACTGCAGGCTAAAGTGCTCTGG - Intergenic
1173098837 20:40064874-40064896 CACTGCAGGCTAAGGTGCTATGG + Intergenic
1173198180 20:40933156-40933178 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1173505272 20:43582170-43582192 CTCAGGAGGCTGAGGTACTCAGG - Intronic
1173617114 20:44410489-44410511 CCCAGCAGGCTGAGGAGGGGTGG - Intronic
1173807674 20:45936591-45936613 CTCAGGAGGCTGAGGTGGAAGGG - Intronic
1174025620 20:47571833-47571855 CTCAGGAGGCTGAGGTGGAAGGG - Intronic
1174201660 20:48810474-48810496 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
1174295964 20:49545309-49545331 CTCAGGAGGCTGAGGTGGGGAGG + Intronic
1175047375 20:56119803-56119825 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1175196901 20:57250421-57250443 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1175445429 20:59016441-59016463 CACTGCAGGTTGAAGTGCTCTGG + Intergenic
1175734873 20:61378144-61378166 CTCAGCAGGCTGAGGTGGGAGGG + Intronic
1175864659 20:62168850-62168872 CACAGCAGGATGAGTGGGACAGG + Intronic
1175998023 20:62820031-62820053 CAGAGCAGCCAGAGGTGGCCAGG - Intronic
1176100235 20:63361373-63361395 CCCAGCCGGCTGAGGCGGGCAGG - Exonic
1176375981 21:6087107-6087129 CACAGCATGCTGAGGAGCTCGGG - Intergenic
1177193707 21:17880284-17880306 CTCAGGAGGCTGAGGTGGTAGGG + Intergenic
1177592710 21:23192354-23192376 CTCAGAAGGCTGAGGTGGGGGGG + Intergenic
1177819139 21:26012113-26012135 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1178021606 21:28414771-28414793 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1178968362 21:37146409-37146431 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
1178976921 21:37228079-37228101 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1179210917 21:39323552-39323574 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
1179566359 21:42251602-42251624 CACACCAGGCTGGTCTGGTCAGG - Intronic
1179611498 21:42554797-42554819 CACAGGAGGCTCAGGTGCTAGGG - Intronic
1179747494 21:43451137-43451159 CACAGCATGCTGAGGAGCTCGGG + Intergenic
1179932554 21:44579855-44579877 CACAGCAGGAGGAGATGGGCAGG + Exonic
1179981160 21:44896680-44896702 CACAGCAGGCTCAGCAGGACAGG - Intronic
1180672488 22:17564231-17564253 CAGGGCAGGCTGAGGTGGTGGGG - Intronic
1180678987 22:17610021-17610043 CATAGGAGGCTGAGGTGGGAAGG + Intronic
1181102074 22:20547889-20547911 CTCAGGAGGCTGAGGTGGGGAGG + Intronic
1181719909 22:24766059-24766081 CCCAGGAGGCTGAGGTGGGAGGG - Intronic
1181836130 22:25610357-25610379 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1181888895 22:26043873-26043895 CTCAGGAGGCTGAGGAGCTCAGG - Intergenic
1182448002 22:30400785-30400807 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1182469809 22:30541723-30541745 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1183069299 22:35385151-35385173 CCCAGCATGCAGAGGTGGTGGGG + Intronic
1183336527 22:37250739-37250761 CTCAGGAGGCTAAGGTGGGCAGG + Intergenic
1183513058 22:38247071-38247093 CAGAGGAGGCTGATGTGGGCTGG - Intronic
1183675465 22:39296878-39296900 CAGAACAGGCTGGGGTGGGCTGG - Intergenic
1183802705 22:40181286-40181308 CAGAGCAGGCTGAGCAGCTCTGG + Intronic
1184213103 22:43048529-43048551 CACAGGAGGCTGAGGTGAGAAGG + Intronic
1184475042 22:44715758-44715780 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1184646496 22:45898061-45898083 CACACCAGGCAGAGGAGGACGGG + Intergenic
1184716965 22:46287978-46288000 AACAGCAGGCTGAGGGGCACAGG + Intronic
1184894835 22:47400843-47400865 CACTCCAGGCTGTGGAGGTCGGG - Intergenic
1185186936 22:49406940-49406962 CAGAGCAGGCTGTGGTCCTCGGG + Intergenic
949467121 3:4355246-4355268 CTCAGAAGGCTGAGGTGGGGGGG + Intronic
949469532 3:4380102-4380124 CACAGGAGGTGGAGGTGGTAGGG - Intronic
950036014 3:9886237-9886259 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
950064384 3:10100078-10100100 CACAGGAGGCTGAGGTGGGAGGG + Intronic
951111094 3:18805118-18805140 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
951264776 3:20552685-20552707 CAGAGGAGGCTGAGGTGGCAGGG + Intergenic
953341347 3:42136514-42136536 CTCAGGAGGCTAAGGTGGGCGGG + Intronic
953559744 3:43977800-43977822 GTCAGCAGGGTGAGGTGGTGTGG - Intergenic
953791771 3:45952939-45952961 CACTGCAGGCTTACATGGTCAGG + Intronic
954270778 3:49506867-49506889 CTCAGGAGGCTGAGGTGGTGGGG + Intronic
954332575 3:49898759-49898781 CACAGTAGGCTAGGGTGGTAGGG + Intronic
954393810 3:50281784-50281806 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
954434100 3:50486871-50486893 TACTGCAGAGTGAGGTGGTCAGG - Intronic
954645749 3:52130628-52130650 CACACCTGGCTTGGGTGGTCGGG - Intronic
954789138 3:53117995-53118017 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
955773612 3:62410995-62411017 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
956457484 3:69437178-69437200 CTCAGGAGGCTGAGGTGGGTGGG - Intronic
957206043 3:77199696-77199718 CACAGGAGGCTGAGGTGCAGTGG - Intronic
957907686 3:86578771-86578793 CACTACAGGCTGAAGTGCTCTGG - Intergenic
957976201 3:87448011-87448033 CACTGCAGGCTAAAGTGCTCTGG - Intergenic
958268368 3:91467045-91467067 CACTGCTGGCTAAGGTGCTCAGG + Intergenic
960333798 3:116392470-116392492 CAGAGGAGGCTGAGGTGGCAGGG - Intronic
960500132 3:118428102-118428124 CTCAGAAGGCTGAGGTGGGAGGG - Intergenic
961048904 3:123729771-123729793 CCCAGGAGGCTGAGGTGGGAAGG + Intronic
961153849 3:124662309-124662331 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
961505204 3:127366135-127366157 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
961535637 3:127568892-127568914 CACAGCAGGAACAGTTGGTCAGG + Intergenic
961607864 3:128110723-128110745 CACAGCAGGCGGAGCTGAGCGGG - Intronic
961610320 3:128132259-128132281 CACCGCAGGCTAAAGTGCTCTGG + Intronic
961677634 3:128577393-128577415 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
962038875 3:131683783-131683805 CACTGCAGGCTGAAGGGCTCTGG - Intronic
962041885 3:131716029-131716051 CAAAGAAGGCTGAGGTCCTCAGG - Intronic
962733679 3:138305187-138305209 CACAGCAGGCAGAGGTGGCCAGG - Intronic
962927493 3:140008390-140008412 CACAGCAGGCTGAAGAAGTAAGG - Intronic
963299538 3:143583043-143583065 CTCAGGAGGCTGAGGTGGGACGG + Intronic
964211130 3:154229317-154229339 CTCAGGAGGCTGAGGTGGAAGGG - Intronic
964446871 3:156768293-156768315 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
964770347 3:160218305-160218327 CTCAGCAGGCTGAGGTGGGAGGG + Intergenic
965621140 3:170643372-170643394 CCCAGCTGGCTGTGGTGGCCTGG - Intronic
965656399 3:170989501-170989523 CACAGCAGGCAAAGCTGGGCTGG - Intergenic
965755281 3:172020133-172020155 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
967087444 3:186108336-186108358 CCCAGCAGGCTGAGGGCGTCCGG - Intronic
967428455 3:189354570-189354592 CTCAGGAGGCTGAGGTGGAAGGG - Intergenic
968091105 3:195898731-195898753 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
968221096 3:196940966-196940988 CTCAGGAGGCTGAGGTGGGTAGG + Intronic
968283193 3:197492468-197492490 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
968347772 3:198025477-198025499 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
968546995 4:1204333-1204355 CACATCAGGCTGAGGTCATGGGG - Intronic
971415128 4:26419084-26419106 CTCAGGAGGCTGAGGTGGGACGG - Intronic
972496993 4:39643332-39643354 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
972524199 4:39892001-39892023 CTCAGGAGGCTGAGGTGGGGGGG + Intronic
972729428 4:41778900-41778922 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
973572630 4:52256158-52256180 TACAGGAGGCTGAAGTGGCCAGG + Intergenic
974309559 4:60187499-60187521 CACTGCAAGCTGAAGTGCTCTGG + Intergenic
975537077 4:75462083-75462105 AACAGCAGGCTGATGAGGACAGG + Intergenic
976076752 4:81307582-81307604 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
976261098 4:83145676-83145698 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
976709660 4:88055442-88055464 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
976722314 4:88180642-88180664 CTCAGGAGGCTGAGGTGGGGGGG + Intronic
976725285 4:88210295-88210317 CACTGGAGGCTGAGGTGGGAAGG - Intronic
978033897 4:103971671-103971693 CAAACCAGGCAGTGGTGGTCAGG - Intergenic
978217723 4:106226054-106226076 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
978804546 4:112786630-112786652 TTCAGGAGGCTGAGGTGGGCAGG - Intergenic
980327561 4:131367987-131368009 CTCAGGAGGCTGAGGTGGAAGGG - Intergenic
982360232 4:154511595-154511617 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
982722137 4:158869837-158869859 CAGAGCAGCGTGAGGTGGTTGGG + Intronic
982754311 4:159200358-159200380 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
982828380 4:160028095-160028117 CACAGCAGGCTGAAGTGCTTTGG - Intergenic
983840855 4:172455479-172455501 CACAGCAGCCTGAAGTGACCTGG + Intronic
983902046 4:173146261-173146283 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
984260527 4:177439303-177439325 CCCAGGAGGCAGAGGTTGTCGGG + Intronic
984814055 4:183820997-183821019 CTCAGGAGGCTGAGGTGGCAGGG + Intergenic
985299319 4:188471464-188471486 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
985522978 5:387623-387645 CAGAAGAGGCTGAGGAGGTCAGG - Intronic
985621324 5:957674-957696 CAGAGAAGGCTGCGGTGCTCAGG - Intergenic
985719720 5:1482614-1482636 CAGGGCAGGCTGGGGTGGGCTGG + Intronic
986060702 5:4187651-4187673 CCCAGGAGGCTGAGCTGCTCTGG - Intergenic
986971222 5:13339381-13339403 CACTGGAGGCTGAGGTGGGAGGG - Intergenic
987019256 5:13852640-13852662 CACAGCAGTCTGAAGTCGACCGG + Intronic
987157798 5:15108600-15108622 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
987471710 5:18339012-18339034 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
988136320 5:27175911-27175933 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
988931611 5:36040712-36040734 CACCGCAGGCTAAAGTGCTCTGG + Intronic
989174733 5:38512530-38512552 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
989391203 5:40902669-40902691 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
989690930 5:44143123-44143145 CACAGCTGGCTAAAGTGCTCTGG - Intergenic
990653649 5:57930582-57930604 CACAGAAGTCTGAGCTGGACAGG - Intergenic
991456322 5:66808202-66808224 CACCGCAGCCTGAGGTTGTTAGG + Intronic
991715250 5:69445779-69445801 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
991769834 5:70029852-70029874 CTCAGAAGGCTGAGGTGGGAGGG - Intronic
991849129 5:70905271-70905293 CTCAGAAGGCTGAGGTGGGAGGG - Intronic
992057802 5:73009642-73009664 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
992693184 5:79259641-79259663 CGCAGCAGGCTGAAGTGGCAGGG + Intronic
992862233 5:80922904-80922926 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
993572192 5:89555067-89555089 CTCAGGAGGCTGAGATGCTCAGG + Intergenic
993610906 5:90052995-90053017 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
993981172 5:94545231-94545253 CACCACAGGCTGCGGTGCTCTGG + Intronic
994092315 5:95820241-95820263 CACGGGAGGCTGAGGTGGGAGGG + Intronic
994310163 5:98259939-98259961 CACCACAGGCTGAAGTGCTCTGG - Intergenic
994668910 5:102743175-102743197 CACAGTAAGCTAAAGTGGTCTGG + Intergenic
994992124 5:107010203-107010225 CGCAGCAGGCTCAGGTTGCCTGG - Intergenic
995348567 5:111149038-111149060 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
995514232 5:112938446-112938468 CTCAGGAGGCTGAGGTGGGCAGG + Intergenic
996961594 5:129256171-129256193 CACTCCAGCCTGAGGTGGTGAGG + Intergenic
997285460 5:132675023-132675045 CAGAGCAAGCTGAGGAGCTCTGG - Intronic
997371401 5:133363494-133363516 TACTTCAGGCTGCGGTGGTCAGG - Intronic
997556245 5:134801161-134801183 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
997908184 5:137841397-137841419 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
998133188 5:139661216-139661238 CAGAGCAGGGTGAGCTGGGCGGG + Intronic
998236014 5:140399780-140399802 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
999143857 5:149379938-149379960 CACAGCAGGCTGAAATTGTGCGG - Intronic
1000311637 5:160050731-160050753 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1000339163 5:160264051-160264073 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1000947490 5:167439143-167439165 CAAAGGAGGCAGAGGTGATCAGG + Intronic
1001157415 5:169285016-169285038 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1001607527 5:172972680-172972702 CCCAGGAGGCTGAGGTGGGGAGG + Intergenic
1001750783 5:174129484-174129506 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1002038913 5:176496234-176496256 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1002118840 5:176985710-176985732 CACAGGAAGCTGAGGTGGGAGGG - Intronic
1002281855 5:178135255-178135277 CTCAGAAGGCTGAGGTGGGACGG - Exonic
1004188991 6:13447885-13447907 CACAGAGGGCTGAGGAGGGCTGG + Intronic
1006859660 6:37162456-37162478 CAGAGGAGGCTGAAGAGGTCCGG - Intergenic
1006868016 6:37224696-37224718 CTCAGAAGGCTGAGGTGGGAGGG - Intronic
1006955107 6:37862574-37862596 CTCAGGAGGTTGAGGTGGGCGGG + Intronic
1006964225 6:37965868-37965890 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1007654236 6:43442620-43442642 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
1007672177 6:43564707-43564729 CTCAGAAGGCTGAGGTGGGAGGG - Intronic
1008986836 6:57554540-57554562 CACTGCTGGCTAAGGTGCTCAGG - Intronic
1009174796 6:60447102-60447124 CACTGCTGGCTAAGGTGCTCAGG - Intergenic
1010149020 6:72708627-72708649 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1010501948 6:76611546-76611568 ATCAGAAGGCTGAGGTGGTAGGG + Intergenic
1011598300 6:89037284-89037306 CACTACAGGCTGAAGTGCTCTGG + Intergenic
1012190694 6:96276555-96276577 CACTGCAGGCTAAAGTGCTCTGG + Intergenic
1012282256 6:97342194-97342216 CCCAGGAGGCTGAGGTGGAAGGG + Intergenic
1013837191 6:114346331-114346353 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1014026006 6:116646680-116646702 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1015280562 6:131429780-131429802 CTCAGTAGGCTGAGGTGGGAGGG + Intergenic
1015297701 6:131616710-131616732 CTCAGGAGGCTGAGGTGGGGAGG + Intronic
1015537358 6:134280085-134280107 CTCAGAAGGCTGAGGTGGAAGGG + Intronic
1015615530 6:135070537-135070559 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1015624538 6:135166670-135166692 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1015802800 6:137077655-137077677 CTCAGGAGGCTGAGGTGGAAGGG + Intergenic
1016054817 6:139567340-139567362 CACTGCAGGCTAAAGTGCTCTGG - Intergenic
1016153894 6:140780327-140780349 CACTGCAGGCTAAAGTGCTCCGG + Intergenic
1016214967 6:141588371-141588393 GACAGAAGGCAGAGGTGCTCTGG + Intergenic
1016813300 6:148281532-148281554 CACAGGAGGCTGAAGTCATCAGG - Intronic
1017491578 6:154950261-154950283 CACTGCAGGCTCAAGTGCTCTGG - Intronic
1017731095 6:157316766-157316788 CACAGGAGGCTGAGGTGGGAAGG + Intronic
1018690532 6:166340662-166340684 CAGAGCAGGTTGAGGAGGTTGGG - Intronic
1019109799 6:169700827-169700849 CACAGCAGGGAGAGGAGGTAGGG - Intronic
1019993133 7:4706405-4706427 AACAGCAAGGGGAGGTGGTCAGG + Intronic
1020056717 7:5122661-5122683 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1020089637 7:5331800-5331822 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1020171187 7:5846301-5846323 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1021570493 7:22059960-22059982 CACAGCATGCCGAGGTGGGTGGG - Intergenic
1022223678 7:28340761-28340783 CACTGCAGGCTAAAGTGTTCTGG - Intronic
1024270591 7:47638571-47638593 CACAGCAGGGTGAGGTAGCAGGG - Intergenic
1025247020 7:57325188-57325210 CTCCTCAGGCTGGGGTGGTCAGG + Intergenic
1025843391 7:65173186-65173208 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1025879654 7:65522781-65522803 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1025893783 7:65679807-65679829 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1025951974 7:66152543-66152565 GAAAACAGGCTGAGGTTGTCAGG + Exonic
1026119325 7:67522979-67523001 CACAGCAGGCCTATGTGTTCTGG - Intergenic
1026212362 7:68317035-68317057 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1026350659 7:69512523-69512545 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
1026352744 7:69531770-69531792 CACAGGAGGCTGAGGTGGGAAGG + Intergenic
1026971551 7:74471566-74471588 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1027204160 7:76083785-76083807 CTAGGGAGGCTGAGGTGGTCAGG + Intergenic
1027867112 7:83662308-83662330 CTCAGCAGGCTGAGGTGGGAGGG - Intergenic
1028179959 7:87707564-87707586 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1028725385 7:94081177-94081199 CACAACATGCTGAGGTGGGAAGG - Intergenic
1029323432 7:99785246-99785268 CATTGCTGGCTGAGGTGGTTGGG - Intergenic
1029454810 7:100663907-100663929 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1029515475 7:101020635-101020657 CACAGCAGGGTGTGCTGGTGTGG - Intronic
1029735396 7:102463063-102463085 CCCAGGAGGCTGAGGTGGGAGGG - Intronic
1030078154 7:105754566-105754588 CTCAGCAGGCTGAGGTGGGAGGG - Intronic
1030844309 7:114390660-114390682 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1030887860 7:114961079-114961101 CAGAGCAGGCAGGGGTGGTGCGG - Intronic
1031732554 7:125316541-125316563 CACTGCAGACTGAAGTGCTCTGG + Intergenic
1031805207 7:126299670-126299692 CTCAGGAGGCTGAGGTGGTAGGG - Intergenic
1032106592 7:129036322-129036344 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1032165092 7:129539275-129539297 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1032301373 7:130690596-130690618 CTCAGGAGGCTGAGGTGGGTGGG - Intergenic
1032450143 7:132023656-132023678 GACAGAAGGCTGATGTGGTGGGG + Intergenic
1033014387 7:137657313-137657335 CACAGCAGGGCCAAGTGGTCTGG + Intronic
1034055147 7:148026341-148026363 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
1034519041 7:151604529-151604551 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1034907479 7:154963414-154963436 GACAGGAGGCCGAGGTGGACGGG - Intronic
1035548809 8:504110-504132 CAGGGCAGGCTCAGGTGGACTGG - Intronic
1035635115 8:1138509-1138531 TAGAGCAGGCTGGGGTGGGCTGG + Intergenic
1035738527 8:1907532-1907554 AACAGCAGCCTGAGGGGTTCTGG - Intronic
1036577730 8:10044350-10044372 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
1037459728 8:19096998-19097020 CTCAGGAGGCTGAGGTGGGGGGG - Intergenic
1037663187 8:20944339-20944361 CTGAGCAGGCTGAGGGGTTCCGG - Intergenic
1037827367 8:22167440-22167462 CACAGCAGGCTGAGAAGGTCTGG + Intronic
1038286096 8:26207477-26207499 CACAGCAGGCTGAGTAGATGGGG + Intergenic
1038843427 8:31206915-31206937 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1039339417 8:36630481-36630503 CTCTAAAGGCTGAGGTGGTCAGG + Intergenic
1039702934 8:39979927-39979949 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1039812464 8:41061774-41061796 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1039897703 8:41727950-41727972 CCGGGCAGGATGAGGTGGTCCGG - Exonic
1040339565 8:46433596-46433618 CACAGCAGGATGACATGGGCAGG + Intergenic
1040339834 8:46434936-46434958 GACAGCAGGGTGGAGTGGTCGGG - Intergenic
1040901379 8:52420114-52420136 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1041077206 8:54179630-54179652 CAGAGGAGGCTGAGTTGGTCAGG - Intergenic
1041558939 8:59192003-59192025 CTCAGAAGGCTGAGGTGGGAAGG + Intergenic
1041704554 8:60832127-60832149 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1041715900 8:60931800-60931822 CTCAGGAGGCTGAGGTGGCAGGG - Intergenic
1041731885 8:61070730-61070752 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1042257302 8:66818001-66818023 CTCAGGAGGCTGAGGTAGTGAGG + Intronic
1042320710 8:67472531-67472553 CTCGGAAGGCTGAGGTGGTTAGG - Intronic
1042404501 8:68388367-68388389 CTCAGCTAGCTGAGGTGATCAGG - Intronic
1042432487 8:68724973-68724995 CCCAGGAGGCTGAGGTGCTGAGG - Intronic
1042615523 8:70644577-70644599 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1042898292 8:73694980-73695002 CACCACAGGCTGAAGTGCTCCGG + Intronic
1043659010 8:82711077-82711099 CTCAGAAGGCTGAGGTGGGAGGG + Intergenic
1043708101 8:83378427-83378449 CAGAGGAGGCTGAGGTGGCAGGG + Intergenic
1043932338 8:86105404-86105426 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1044405264 8:91819014-91819036 CACAGCAGTCTGAAGTGACCTGG + Intergenic
1044565667 8:93659100-93659122 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1044649709 8:94481486-94481508 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1044718876 8:95126744-95126766 CTCAGAAGGCTGGGGTGGTAAGG - Intergenic
1044775012 8:95678440-95678462 CAGAGCTGGCTGAGGTGGCATGG + Intergenic
1045172632 8:99687463-99687485 CACTGCAGGCTAAAGTGCTCTGG - Intronic
1045679874 8:104647072-104647094 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1045854281 8:106745633-106745655 CACAGAAGGCTCTGGTGGTTTGG - Intronic
1046325672 8:112641728-112641750 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1047396371 8:124502894-124502916 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1047467770 8:125135013-125135035 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049714216 8:144082354-144082376 GACAGCAGGCCGAGCTGGTCGGG - Intergenic
1049864868 8:144928234-144928256 CTCAGGAGGCTGAGGTGGCAGGG + Intergenic
1049906513 9:222153-222175 CATAGAAGGCTGAGGTGGGAGGG + Intronic
1050183860 9:2950439-2950461 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
1050706211 9:8401270-8401292 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1050975600 9:11934140-11934162 CACAGCAGCATGAGGTAATCTGG - Intergenic
1051039205 9:12785489-12785511 CACTGCAGGCTAAAGTGCTCTGG - Intronic
1051712580 9:19947151-19947173 CACTGCAGGCTCAGTTGGTCTGG - Intergenic
1053171600 9:35890853-35890875 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1053258650 9:36641681-36641703 CACAGGAGGCGGAGGTTGTGGGG - Intronic
1053406308 9:37879288-37879310 CACACCAGACTGAGGAGTTCAGG + Intronic
1053460787 9:38269612-38269634 CAAAGCAGGCTGGGCTGGTGAGG + Intergenic
1053786292 9:41655075-41655097 TACAGCAGGCTGTGGGGGTGGGG + Intergenic
1053795151 9:41719928-41719950 CTCAGAAGGCTGAGGTGGGAGGG - Intergenic
1054151383 9:61608603-61608625 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1054158761 9:61659124-61659146 TACAGCAGGCTGTGGGGGTGGGG - Intergenic
1054175005 9:61869019-61869041 TACAGCAGGCTGTGGGGGTGGGG + Intergenic
1054183563 9:61931995-61932017 CTCAGAAGGCTGAGGTGGGAGGG - Intergenic
1054478535 9:65590129-65590151 TACAGCAGGCTGTGGGGGTGGGG - Intergenic
1054654944 9:67656492-67656514 CTCAGAAGGCTGAGGTGGGAGGG + Intergenic
1054662532 9:67711774-67711796 TACAGCAGGCTGTGGGGGTGGGG - Intergenic
1054711349 9:68514223-68514245 CTCAGGAGGCTGAGGTGGGGAGG + Intronic
1054935704 9:70685511-70685533 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1055386841 9:75771810-75771832 CACAGCAGTCTGAGGTCGAATGG - Intergenic
1056348831 9:85727082-85727104 CACTCCAGGATGAGGTGGTCAGG + Intronic
1056388708 9:86120415-86120437 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1056549330 9:87638657-87638679 CAAGGCAGGAAGAGGTGGTCTGG + Intronic
1056673969 9:88657267-88657289 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1056798578 9:89675657-89675679 GACAGATGGCTGAGGTGGGCTGG + Intergenic
1056926426 9:90838613-90838635 CCCAGCAGGCTGAGGGGTACAGG + Intronic
1057084767 9:92199063-92199085 CATAGGAGGCTGAGGTGGGCGGG + Intergenic
1057144575 9:92749319-92749341 CACAGGAGGCTGAGGGGCACTGG + Intronic
1057238189 9:93383221-93383243 TTCAGGAGGCTGAGGTGGGCGGG + Intergenic
1057514669 9:95711132-95711154 CACAGCAGGCTGTTTCGGTCAGG - Intergenic
1057880586 9:98790193-98790215 TCCAGCACGCTGAGGTGGTCAGG + Exonic
1058285835 9:103176839-103176861 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1058444886 9:105046135-105046157 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1059072341 9:111151982-111152004 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1060313357 9:122484924-122484946 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1060404796 9:123367897-123367919 CATAGTGGGCTGAGGTTGTCTGG + Intronic
1060488656 9:124065653-124065675 CCCAGCAGGAAGAGATGGTCTGG + Intergenic
1060584874 9:124779673-124779695 CCCAGCTGGCTGAAGTGGTTTGG - Intronic
1061674234 9:132206824-132206846 CAGTGGAGGCTGATGTGGTCTGG - Intronic
1062392194 9:136338288-136338310 CACAGCAGTCTCAGGTCCTCCGG + Intronic
1062561016 9:137141901-137141923 CCCAGCAGGCTAAGGGGGGCTGG - Intronic
1185516818 X:706217-706239 CTCAGAAGGCTGAGGTGGGAAGG - Intergenic
1185678004 X:1864469-1864491 CTCAGGAGGCTGAGGTGGAGGGG - Intergenic
1185762375 X:2698572-2698594 CACAGAAGGCTAAGGTGGGCAGG - Intronic
1185863731 X:3604025-3604047 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1185888787 X:3806057-3806079 CTCAGGAGGCTGAGGAGTTCAGG + Intergenic
1186020550 X:5250772-5250794 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1186602236 X:11050156-11050178 CACTGCAGGCTAAAGTGCTCTGG - Intergenic
1186750211 X:12614048-12614070 CTCAGCAGGCTGAGGTGGGAGGG + Intronic
1186752701 X:12638342-12638364 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1186802436 X:13106696-13106718 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1187417224 X:19103835-19103857 CACAGCAGGCAGAGATGTTTGGG - Intronic
1188541372 X:31254462-31254484 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1190111726 X:47594124-47594146 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
1190290226 X:48987696-48987718 CACATCAGGGTAGGGTGGTCTGG - Intronic
1190752599 X:53375253-53375275 CAGGACAGGCAGAGGTGGTCAGG - Exonic
1190767573 X:53488333-53488355 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1190811393 X:53887702-53887724 CTCAGAAGGCTGAGGTGGGAGGG + Intergenic
1190857441 X:54310437-54310459 CTCAGTAGGCTGAGGTGGGAGGG + Intronic
1191024267 X:55896621-55896643 CACAGCAAGCTGAGGTCCACTGG + Intergenic
1192088071 X:68121552-68121574 CACTGCAGGCTAAAGTGCTCTGG + Intronic
1192388296 X:70696659-70696681 CTCAGAAGGCTGAGGTGGAAGGG + Intronic
1192409841 X:70924368-70924390 CTCAGGAGGCTGAGGTGGAAGGG - Intergenic
1192534597 X:71916580-71916602 CACCACATGCTGATGTGGTCAGG - Intergenic
1193064062 X:77238845-77238867 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1193122861 X:77841781-77841803 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1193894796 X:87099989-87100011 CACTGTAGGCTGAAGTGCTCTGG + Intergenic
1194203514 X:90983578-90983600 CACAGCAGTCTGAAGTTGACCGG + Intergenic
1194664973 X:96667294-96667316 TTCAGGAGGCTGAGGTGGGCTGG + Intergenic
1195115658 X:101695882-101695904 CACTGCAGGCTAAAGTGTTCTGG + Intergenic
1195541534 X:106068261-106068283 CACTGCAAGCAGATGTGGTCAGG + Intergenic
1195774826 X:108391547-108391569 CACAGCAGTCTGAGGTCGACTGG - Intronic
1195961027 X:110387032-110387054 CACTTGGGGCTGAGGTGGTCAGG + Intronic
1196055604 X:111351830-111351852 CACAGGAGGCTGAAGTGGGGAGG - Intronic
1196310493 X:114158484-114158506 CACAAGAGGCTGAGGTGGGAGGG + Intergenic
1196426640 X:115576461-115576483 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1196665431 X:118311047-118311069 CCCAGGAGGCTGAGGTGGGAGGG + Intergenic
1197213177 X:123845015-123845037 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1197654522 X:129102173-129102195 CTCAGAAGGCTGAGGTGGGAGGG + Intergenic
1197744546 X:129922885-129922907 CACAGCGGGCTGAGATTGTGGGG + Intronic
1197793846 X:130280743-130280765 CAAACCAGGCGGTGGTGGTCAGG - Intergenic
1198702655 X:139414386-139414408 CACTGCAGGCTAAAGTGTTCTGG - Intergenic
1198790770 X:140343018-140343040 CTCAGAAGGCTGAGGTGGGAGGG + Intergenic
1198947654 X:142032055-142032077 CACAACAGGCTAAAGTGCTCTGG - Intergenic
1199221156 X:145316897-145316919 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1199764505 X:150931083-150931105 CTCAGGAGGCTGAGGTGGAAGGG + Intergenic
1199979456 X:152912978-152913000 CACAGCAGGCTCGGGCTGTCTGG + Intergenic
1200157827 X:153986822-153986844 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
1200237631 X:154476058-154476080 CTCAGGAGGCTGAGGTGCTGGGG + Intergenic
1200473682 Y:3618973-3618995 CACAGCTTGGTGAGGTGGTTTGG - Intergenic
1200775887 Y:7170137-7170159 CACTGCTGGCTGGGGTGGCCAGG - Intergenic
1201705660 Y:16933920-16933942 CACAGGAGGCTGAGGTGGGAGGG - Intergenic
1202039854 Y:20669995-20670017 CTCAGAAGGCTGAGGTGGGATGG + Intergenic
1202342690 Y:23886445-23886467 CACTGCTGGCTTAGGTGGCCAGG + Intergenic
1202528079 Y:25783640-25783662 CACTGCTGGCTTAGGTGGCCAGG - Intergenic