ID: 1073301526

View in Genome Browser
Species Human (GRCh38)
Location 10:102473891-102473913
Sequence GGTGCTGAACCACCGCAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073301518_1073301526 26 Left 1073301518 10:102473842-102473864 CCTGTAAGCTGCTGACCTTGGTG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1073301526 10:102473891-102473913 GGTGCTGAACCACCGCAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1073301521_1073301526 11 Left 1073301521 10:102473857-102473879 CCTTGGTGGTCACTGACCTGGTA 0: 1
1: 0
2: 2
3: 9
4: 136
Right 1073301526 10:102473891-102473913 GGTGCTGAACCACCGCAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1073301524_1073301526 -5 Left 1073301524 10:102473873-102473895 CCTGGTAGACGAGGACCTGGTGC 0: 1
1: 0
2: 1
3: 9
4: 92
Right 1073301526 10:102473891-102473913 GGTGCTGAACCACCGCAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073301526 Original CRISPR GGTGCTGAACCACCGCAAGC AGG Exonic
901136492 1:7000167-7000189 GGAGCTGGGCCACCGAAAGCTGG + Intronic
904499501 1:30906148-30906170 GGTGCGGAACCCCGGCAACCAGG + Intronic
910868119 1:91806326-91806348 GGAGCTGGCCCACCGCCAGCAGG - Intronic
912601239 1:110934965-110934987 TGTCCTGAACCACCTAAAGCTGG - Intergenic
919639571 1:200035522-200035544 GGTGCTGAACCACGGGAAGGAGG + Intronic
1070288457 10:75100025-75100047 GGGGCTGCACCACCCCAGGCAGG + Intronic
1071380100 10:85050558-85050580 GGTGCTGAAACACCTGAAGGTGG - Intergenic
1071849573 10:89554921-89554943 GGTGTTGAGGCTCCGCAAGCAGG + Intronic
1073301526 10:102473891-102473913 GGTGCTGAACCACCGCAAGCAGG + Exonic
1074051580 10:109885732-109885754 GGTGCTGAACAACTGCATGAAGG + Intronic
1074759412 10:116655111-116655133 GGTGCTCAACAACCCCATGCAGG + Intergenic
1075386351 10:122058062-122058084 GGTGCTGAACCACTCCATGGTGG - Intronic
1079435058 11:20439007-20439029 GCTGCTGAACCACCCCAGTCTGG - Intronic
1093088994 12:14900638-14900660 GGTGGTGAACCAACGAATGCAGG + Intronic
1097223271 12:57462429-57462451 GGTGGAGAACCACCGGGAGCGGG - Intronic
1101024322 12:100585588-100585610 GGTGATGAACAACCTGAAGCTGG - Intronic
1101613793 12:106316414-106316436 GTGGCTGAAGCACAGCAAGCAGG - Intronic
1104879820 12:132063006-132063028 GGTCCAGAACCACACCAAGCGGG - Intronic
1113465230 13:110507947-110507969 GGTGCTGAACCGCGCCAGGCAGG - Exonic
1118927657 14:70207466-70207488 GATGCTGTAACACTGCAAGCAGG + Intergenic
1125899233 15:43329901-43329923 GGTGCTGACCTACCTCGAGCCGG - Exonic
1132748556 16:1447005-1447027 GGTGGTGGACAACCGCAATCAGG - Exonic
1133847339 16:9467508-9467530 GTTGCTGAAACACAGAAAGCAGG - Intergenic
1134293918 16:12927783-12927805 GGTGCTGAACCACACCATGGAGG + Intronic
1134473112 16:14545751-14545773 GGTGCTGAAACACCTTGAGCTGG - Intronic
1136508590 16:30722252-30722274 GGGGCTGCCCCACAGCAAGCTGG - Exonic
1140646518 16:77037724-77037746 TGTTCTGAACCACCTAAAGCTGG + Intergenic
1141718572 16:85741722-85741744 GGAGCTGTGCCACCTCAAGCAGG + Intronic
1142125235 16:88406884-88406906 GGTGCTGAACAGCCGCTAGGGGG - Intergenic
1142809097 17:2386978-2387000 GGTGGTGCACCACCCCCAGCTGG - Exonic
1143503462 17:7351778-7351800 GGTGCTGAGCCGCCGCATTCCGG - Intergenic
1143656029 17:8294323-8294345 AGTGCTGCCCCACTGCAAGCAGG - Intronic
1143711955 17:8741575-8741597 GGAGCTGACCAAGCGCAAGCAGG - Exonic
1143870664 17:9955594-9955616 GGCTCTGAACCCACGCAAGCCGG + Intronic
1151434534 17:74086764-74086786 GATGCTGGACCACAGCATGCAGG + Intergenic
1151544123 17:74781859-74781881 GTGGCTGAAGCACAGCAAGCCGG - Intronic
1157713229 18:49864236-49864258 CCTGCTGAACCAGCTCAAGCTGG - Exonic
1160808283 19:1001852-1001874 GGAGCTGCACCGCCGCAAGCCGG + Intronic
1163161869 19:15469697-15469719 GCTGCTGGGCCACCGCCAGCTGG - Exonic
1167513954 19:49911938-49911960 ACTGCTGAGCCACCTCAAGCCGG + Intronic
1168470656 19:56638203-56638225 GGTGCTGAACCACTTCCAGCAGG - Intergenic
925892323 2:8445697-8445719 GGTGCTGAACAACAGCCAGGGGG + Intergenic
933934347 2:87188961-87188983 GCTGCAGAACCACCCTAAGCGGG + Intergenic
933971098 2:87470216-87470238 GTAGCTGAACCACACCAAGCTGG - Intergenic
934149121 2:89128651-89128673 GCAGCTGAACCACAGCAAGAAGG + Intergenic
934218174 2:90053391-90053413 GCAGCTGAACCACAGCAAGAAGG - Intergenic
935576463 2:104716793-104716815 TGTGCTGAGCCACCTGAAGCTGG + Intergenic
936029146 2:109057807-109057829 GATGAGTAACCACCGCAAGCTGG - Intergenic
936322630 2:111479973-111479995 GTAGCTGAACCACACCAAGCTGG + Intergenic
936358796 2:111776934-111776956 GCTGCAGAACCACCCTAAGCGGG - Exonic
938089646 2:128423025-128423047 GATGCTCAGCCACAGCAAGCTGG - Intergenic
947892959 2:233642917-233642939 TGTTCTGAGCCACCTCAAGCTGG + Intronic
1169146165 20:3253970-3253992 GGTGGGGAACCACCTCAGGCAGG - Intronic
1174609576 20:51788101-51788123 GGTGCTGAGCCACTGCACCCAGG + Intronic
1175893290 20:62324722-62324744 GGTGCTGGCCCACCTCCAGCCGG - Intronic
1180202102 21:46230033-46230055 GGCGGTGAGCCACAGCAAGCCGG + Intergenic
949906727 3:8864178-8864200 GGTGCTGCACCACCGCCCGAGGG + Intronic
951170416 3:19535272-19535294 AGTGCTGACCCATTGCAAGCTGG - Exonic
951204484 3:19910729-19910751 GGTTCTGAGCCACCTAAAGCTGG - Intronic
952149182 3:30567729-30567751 TGTTCTGAGCCACCGAAAGCTGG - Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
968426409 4:526396-526418 GGTGCTGCACCACCGCATCGCGG + Intronic
969675881 4:8614131-8614153 GGGGCTGAACAACTGCAAGGTGG - Intronic
974562615 4:63541331-63541353 GGTGCTGAACCTAGGTAAGCTGG - Intergenic
980686950 4:136240947-136240969 TGTACTGAACCACCCAAAGCTGG - Intergenic
981347538 4:143694204-143694226 GGTGCTGAAGCCCAGCAAGGAGG + Intronic
981996264 4:150978165-150978187 TGTGCTGAACCACCTGGAGCTGG - Intronic
987350494 5:17017695-17017717 GGTGCTGCACCACTGCAGCCTGG + Intergenic
998338182 5:141392969-141392991 GGGGCTGGACCCCCGGAAGCTGG + Exonic
998513615 5:142733987-142734009 GGTGCAGAACCACCTCATGGAGG + Intergenic
1002021672 5:176367610-176367632 GGTGCTGAGGCACTGCAAGAAGG - Intronic
1002170300 5:177371007-177371029 GGTGCAGCACCACCTCTAGCGGG - Exonic
1014286893 6:119509747-119509769 GCTGCTGAACTACAGCAGGCAGG + Intergenic
1030343852 7:108410780-108410802 GGGTCTGAACCACCCCATGCTGG - Intronic
1030998159 7:116383643-116383665 GCTGCTGAACCACAGCCAGCTGG - Intronic
1031746420 7:125504949-125504971 TGTTCTGAACCACCTAAAGCTGG + Intergenic
1031862402 7:126995022-126995044 TGTGCTGAACCACCTGGAGCTGG - Intronic
1032775631 7:135109905-135109927 GGCTCTGAACCACTGCCAGCTGG + Intronic
1037107043 8:15121708-15121730 GGTCCTGAACCACAGGAGGCTGG + Intronic
1039884010 8:41645429-41645451 GGGGCTGAACCACGGCCTGCTGG - Exonic
1049487555 8:142874465-142874487 GGTGCTGAAACACCTCCAGGTGG - Exonic
1049659654 8:143814085-143814107 GCTGCTGAACTTGCGCAAGCTGG - Exonic
1049694817 8:143977967-143977989 GGTGCTGTACCACGGCACGACGG - Exonic
1049749748 8:144277512-144277534 GGGGCTGAAGCACCGCACGCTGG + Intronic
1052258682 9:26490458-26490480 TGTTCTGAACCACCTAAAGCTGG + Intergenic
1053098747 9:35351683-35351705 GCTGCTGACCCACAGCAAGGGGG - Intronic
1053603340 9:39632213-39632235 GCTGCTGACCCACAGCCAGCTGG - Intergenic
1054250198 9:62710212-62710234 GCTGCTGACCCACAGCCAGCTGG + Intergenic
1054564306 9:66744740-66744762 GCTGCTGACCCACAGCCAGCTGG + Intergenic
1060143199 9:121228018-121228040 GCTGCTGCACCACTGCAACCAGG + Intronic
1062670695 9:137707245-137707267 GGTGCTGAAGCACCACAGGCTGG - Intronic
1190909632 X:54758939-54758961 AGTGCTGAACCATAGCAACCAGG - Exonic
1199980237 X:152916749-152916771 GGGGCTGAACCAGTGCAAGCTGG - Intronic