ID: 1073301894

View in Genome Browser
Species Human (GRCh38)
Location 10:102475909-102475931
Sequence GAGACGCCTGCACATGGTCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073301886_1073301894 26 Left 1073301886 10:102475860-102475882 CCTGTGCTCTGCTGCAGCTCTTC 0: 1
1: 0
2: 2
3: 31
4: 323
Right 1073301894 10:102475909-102475931 GAGACGCCTGCACATGGTCAAGG 0: 1
1: 0
2: 1
3: 6
4: 75
1073301888_1073301894 2 Left 1073301888 10:102475884-102475906 CCTGGTCCCAGTTCACGCTGCAT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1073301894 10:102475909-102475931 GAGACGCCTGCACATGGTCAAGG 0: 1
1: 0
2: 1
3: 6
4: 75
1073301891_1073301894 -4 Left 1073301891 10:102475890-102475912 CCCAGTTCACGCTGCATGGGAGA 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1073301894 10:102475909-102475931 GAGACGCCTGCACATGGTCAAGG 0: 1
1: 0
2: 1
3: 6
4: 75
1073301892_1073301894 -5 Left 1073301892 10:102475891-102475913 CCAGTTCACGCTGCATGGGAGAC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1073301894 10:102475909-102475931 GAGACGCCTGCACATGGTCAAGG 0: 1
1: 0
2: 1
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073301894 Original CRISPR GAGACGCCTGCACATGGTCA AGG Exonic
901954027 1:12771087-12771109 GAGGCGCCTGGAAAGGGTCAGGG - Intergenic
905671022 1:39789805-39789827 GTGATGCTTGCACATCGTCAGGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
922577076 1:226668093-226668115 GAATCGCCAGCTCATGGTCATGG - Intronic
1067663712 10:48255854-48255876 GAGAAGCCCGCTCATGGTGAGGG + Intronic
1072443836 10:95480834-95480856 GAGATGCATGCACAGGGTGAAGG + Intronic
1073301894 10:102475909-102475931 GAGACGCCTGCACATGGTCAAGG + Exonic
1075986494 10:126790050-126790072 CAGAAGACTGCACATGGTCAAGG + Intergenic
1076632851 10:131862169-131862191 GAGAAGCCTGTACATGGTGCAGG + Intergenic
1078414259 11:11152411-11152433 GAGAGGCCTGCATCTGGTGAGGG + Intergenic
1080385388 11:31807844-31807866 GGGACCCCTGCACTGGGTCAGGG - Intronic
1081656058 11:44858323-44858345 GGGAAGCCTTCACATGCTCACGG + Intronic
1083054944 11:59810644-59810666 CAGCAGCCTCCACATGGTCACGG + Exonic
1084369606 11:68731747-68731769 GAGACACCAGCACGAGGTCAGGG + Intronic
1084461974 11:69301406-69301428 GAGAAGACTGGCCATGGTCAAGG - Intronic
1084475119 11:69384558-69384580 GAGACGACTGCAGATGCCCAAGG - Intergenic
1085725325 11:78950101-78950123 GAGAAGCCTGCCCATTGTCCAGG + Intronic
1087483765 11:98734904-98734926 GAAAAGCCTGTACATGCTCAAGG - Intergenic
1094517346 12:31145207-31145229 GAGACGGCAGCACGTGGTGAAGG - Intergenic
1098178351 12:67818056-67818078 GAGATCCCTGCAGATAGTCATGG - Intergenic
1101477553 12:105064867-105064889 GAGACTCCAGCACCTGGTCAAGG - Intronic
1105049485 12:133035958-133035980 GAGACAACTGCACATGGTCGGGG + Intergenic
1106975619 13:35209314-35209336 GAGGCGCTTGCATATCGTCAAGG - Intronic
1113461681 13:110486323-110486345 GAGAGCCCTGCCCAGGGTCAGGG - Intronic
1113616706 13:111685459-111685481 GAGATGCTTGCACATGGCGATGG + Intergenic
1113622236 13:111770730-111770752 GAGATGCTTGCACATGGCGATGG + Intergenic
1120049618 14:79849959-79849981 GAGAACCCTGTACATGGACATGG - Intronic
1123156744 14:106234577-106234599 GAGACGCTCACACAGGGTCAGGG - Intergenic
1125470277 15:39995438-39995460 GAAAAGACTGCACATGGTCAGGG - Intronic
1132650560 16:1019724-1019746 GAGACGCCAGCGCAGGGCCAGGG - Intergenic
1137309529 16:47240589-47240611 GAGATGCATGCCCATGTTCATGG + Intronic
1145207934 17:20994598-20994620 GTGGCGCCTGCACAAAGTCAGGG - Intergenic
1159596014 18:70383560-70383582 GAAACGGCAGCACATCGTCAAGG - Intergenic
1160764676 19:802184-802206 GAGACTCCGGCACCTGCTCAAGG - Intronic
1161683791 19:5693382-5693404 GACAGGCCTGCCCATGGCCAGGG + Exonic
1167862589 19:52297334-52297356 GAGACGCCTGAATTTGGTCGGGG - Intronic
930912487 2:56646460-56646482 GGGAGGCCTGCTGATGGTCATGG - Intergenic
935536220 2:104297753-104297775 GAGGCAACTGCACATGGGCAAGG - Intergenic
937850440 2:126627694-126627716 GAGATAACTGCACATGCTCAAGG - Intergenic
945572503 2:211486669-211486691 GTGTCGCTTGCACAGGGTCATGG - Intronic
948966627 2:241386582-241386604 GAGACAGCTGCACATGCCCAGGG - Intronic
1171196775 20:23206053-23206075 CAGGCTCCTGCACCTGGTCAGGG - Intergenic
1171414077 20:24965682-24965704 CAGCCTCCAGCACATGGTCAGGG + Intronic
1172125254 20:32621776-32621798 GAGGTGCCTTCAGATGGTCAGGG + Intergenic
1175061909 20:56251305-56251327 GTGACTCCTGCACACGGCCATGG + Intergenic
1175736211 20:61389268-61389290 GACAGGCCGCCACATGGTCAAGG - Intronic
1178876234 21:36416274-36416296 GAGACGCCTGGAGACGCTCAGGG + Exonic
1179178908 21:39028826-39028848 GAGCCGCCTGCCCTGGGTCAGGG + Intergenic
1182315516 22:29444296-29444318 GAGACGTCTGCAGGTGGCCAAGG - Intergenic
949742479 3:7252382-7252404 GAGTGGTCTGCACATGGTCTGGG + Intronic
955055094 3:55447601-55447623 GAGAAGCTTGCACAAAGTCACGG - Intergenic
956427922 3:69155747-69155769 GAGACACCTGCTCATGTGCAGGG + Intergenic
960673961 3:120177134-120177156 GAAAGGCCTGCACATCTTCAGGG + Intronic
969267123 4:6071763-6071785 GAGACGCCTGCATGTGGTCCAGG + Intronic
969600032 4:8170774-8170796 GAGACGTCTGCAAGTGGCCAAGG - Intergenic
976153906 4:82122109-82122131 GAGAGGCCTGCATCTGGTGAGGG + Intergenic
976775923 4:88706011-88706033 GAGATGCCTGCTCATGGTCCTGG + Intronic
978697144 4:111596041-111596063 GAGAGGTCTGCACATGCTAAAGG - Intergenic
985886870 5:2686874-2686896 GAGACGCCCCCAGCTGGTCAAGG + Intergenic
990295207 5:54394810-54394832 GAGAGCCCTTCAAATGGTCAGGG - Intergenic
997656409 5:135558036-135558058 GAGACGTTTGCTCAAGGTCAGGG - Intergenic
1002516488 5:179762773-179762795 GACACTCCTGCAAATGCTCAGGG + Intronic
1005812626 6:29528983-29529005 GAGTCCCCTGCATAAGGTCAGGG - Intergenic
1006367417 6:33623666-33623688 GTGAGGCCTGCACAAGGGCAGGG - Intronic
1006992519 6:38227623-38227645 AAGACTCCTGCAGAAGGTCACGG + Intronic
1012156926 6:95830857-95830879 GACACGTCTTCACATGGCCAGGG + Intergenic
1013063531 6:106660749-106660771 GAGAAGCCAGCACCTGGTGAGGG + Intronic
1013975223 6:116069735-116069757 GTGAGACCTGCAGATGGTCAGGG + Intergenic
1015483252 6:133739707-133739729 AAGACTCCTGCAAATGTTCATGG - Intergenic
1017758471 6:157549590-157549612 GAGACTCCTGCACAAGGTCAGGG + Intronic
1018056378 6:160055662-160055684 AAGACACCTGCCCAGGGTCACGG - Intronic
1019219362 6:170462307-170462329 GAGACTCCTGAAGACGGTCAAGG + Intergenic
1026807306 7:73436330-73436352 GGGACGCCTGCGGATGTTCAGGG + Intergenic
1028286460 7:89008909-89008931 GAGAAACCTGAACATGTTCAAGG - Intronic
1029941452 7:104484707-104484729 GAAGGGCCTGCACCTGGTCAGGG + Intronic
1039675110 8:39654656-39654678 GAAACGCTTGCACATGTTAATGG - Intronic
1040642026 8:49346183-49346205 GGGAGGCCTGCACATGCACAGGG - Intergenic
1040838155 8:51754400-51754422 GAGAAGCCTGCCCAAGGGCAGGG + Intronic
1042223259 8:66494193-66494215 GAGAAGCCAGCCCAGGGTCAGGG - Intronic
1048398148 8:134034785-134034807 GCAATGCCTGCACATGGTAATGG - Intergenic
1049252471 8:141596671-141596693 GAGATTCCTGGACAAGGTCAGGG + Intergenic
1049440820 8:142608817-142608839 GAGACAGCTGCACAGGGTCTGGG + Intergenic
1049822710 8:144645858-144645880 GAGACACCTGCAGATGCTCCCGG + Intergenic