ID: 1073305820

View in Genome Browser
Species Human (GRCh38)
Location 10:102502683-102502705
Sequence GCGCTAGCGGCGGACCCGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073305820_1073305827 15 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305827 10:102502721-102502743 GCAGTCTAGCCGCCGGTTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1073305820_1073305831 24 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305831 10:102502730-102502752 CCGCCGGTTCAGGGCGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1073305820_1073305825 8 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305825 10:102502714-102502736 CGCATGCGCAGTCTAGCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1073305820_1073305828 18 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305828 10:102502724-102502746 GTCTAGCCGCCGGTTCAGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1073305820_1073305826 14 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305826 10:102502720-102502742 CGCAGTCTAGCCGCCGGTTCAGG 0: 1
1: 0
2: 0
3: 1
4: 9
1073305820_1073305829 23 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305829 10:102502729-102502751 GCCGCCGGTTCAGGGCGGCGAGG 0: 1
1: 0
2: 0
3: 8
4: 85
1073305820_1073305833 29 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305833 10:102502735-102502757 GGTTCAGGGCGGCGAGGGAGCGG 0: 1
1: 0
2: 0
3: 26
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073305820 Original CRISPR GCGCTAGCGGCGGACCCGGC TGG (reversed) Exonic