ID: 1073305820

View in Genome Browser
Species Human (GRCh38)
Location 10:102502683-102502705
Sequence GCGCTAGCGGCGGACCCGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073305820_1073305827 15 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305827 10:102502721-102502743 GCAGTCTAGCCGCCGGTTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1073305820_1073305829 23 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305829 10:102502729-102502751 GCCGCCGGTTCAGGGCGGCGAGG 0: 1
1: 0
2: 0
3: 8
4: 85
1073305820_1073305825 8 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305825 10:102502714-102502736 CGCATGCGCAGTCTAGCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1073305820_1073305833 29 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305833 10:102502735-102502757 GGTTCAGGGCGGCGAGGGAGCGG 0: 1
1: 0
2: 0
3: 26
4: 301
1073305820_1073305826 14 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305826 10:102502720-102502742 CGCAGTCTAGCCGCCGGTTCAGG 0: 1
1: 0
2: 0
3: 1
4: 9
1073305820_1073305831 24 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305831 10:102502730-102502752 CCGCCGGTTCAGGGCGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1073305820_1073305828 18 Left 1073305820 10:102502683-102502705 CCAGCCGGGTCCGCCGCTAGCGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1073305828 10:102502724-102502746 GTCTAGCCGCCGGTTCAGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073305820 Original CRISPR GCGCTAGCGGCGGACCCGGC TGG (reversed) Exonic
900243274 1:1626764-1626786 GCGCTAGCGGCGGGGGTGGCAGG - Intronic
908977721 1:69919511-69919533 GTGCGAGCGGCGGACCCTGGCGG - Intronic
917565385 1:176207279-176207301 GCGCGAGCGGCGGAAGAGGCGGG + Exonic
918487626 1:185045810-185045832 GCTCTCGCGGCGGAGACGGCGGG + Intronic
921517149 1:216109062-216109084 GAGCTAGCGGGGGACTTGGCTGG + Intronic
923008005 1:230067381-230067403 GCGCGGGCGGCGGCGCCGGCAGG + Exonic
1073305820 10:102502683-102502705 GCGCTAGCGGCGGACCCGGCTGG - Exonic
1075866019 10:125719844-125719866 CCTCGAGCGGCGGCCCCGGCCGG - Exonic
1083258150 11:61508965-61508987 GCAGTGGCGGCGGCCCCGGCCGG + Exonic
1088893309 11:114060632-114060654 GAGCTAGCGGCGGGCGCGCCAGG - Intronic
1094466082 12:30754925-30754947 GCGCGAGCGGCTGAGTCGGCTGG - Intronic
1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG + Intronic
1107276638 13:38687112-38687134 GCGCTAGCGGCGGAGCTGGACGG + Exonic
1121113397 14:91327777-91327799 GTGCTGGCGGTGGACCCTGCTGG - Intronic
1121320260 14:92987952-92987974 GCGCCAGCTGCAGACCAGGCCGG - Intronic
1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1129162161 15:73752977-73752999 GGGCGAGCGGCGGGCCGGGCCGG + Intergenic
1129823702 15:78620806-78620828 GGGCTGGCCGCGGACCCGGACGG + Exonic
1133332332 16:4982338-4982360 GCGCTAGGAGCAGACCCCGCTGG + Intronic
1133784501 16:8963753-8963775 GCGGGAGCGGCGGAGCGGGCGGG + Intronic
1136544726 16:30948694-30948716 GGGCAAGCGGGGGACCCAGCCGG + Exonic
1140209414 16:72958986-72959008 GGGCCAGCGGCGGAGCCCGCTGG + Exonic
1144840717 17:18184103-18184125 GCGTGAGTGGGGGACCCGGCGGG - Intronic
1146057694 17:29589423-29589445 GCGCGGGCGGCGGGCCCGGGCGG + Exonic
1146062264 17:29613588-29613610 GCGCTGGCGAGGGTCCCGGCAGG - Exonic
1147879817 17:43646277-43646299 GCGCTGGCGGCGGCCAAGGCCGG - Intronic
1147996768 17:44363855-44363877 GCGCTTGCGGCGGCTCCGGTCGG - Exonic
1150764681 17:67993742-67993764 GCGCCAGGCGCGGGCCCGGCGGG + Intergenic
1151875959 17:76868481-76868503 GCGCGGGCGGCGGAGCCAGCGGG + Intronic
1152596838 17:81241923-81241945 GTGCTAGCGGCTGACCCCGTGGG + Intergenic
1156099733 18:33578719-33578741 GGGCGAGCGGCGGGGCCGGCGGG - Intronic
1160100501 18:75916248-75916270 GCGCTGGACGCGGGCCCGGCGGG - Intergenic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1163158909 19:15453337-15453359 GCCCCTGCGGCGGCCCCGGCCGG - Exonic
1168293004 19:55366120-55366142 GCGCCAGCGGGGGCGCCGGCGGG + Exonic
927159244 2:20242430-20242452 GCGCTCTCGGCGGACGGGGCGGG + Intergenic
930358383 2:50347508-50347530 GCGCTAGCGGGCGAGCCGGCCGG - Intronic
932567356 2:72918150-72918172 GCGCCCGCGGCGGCCGCGGCAGG - Exonic
935112456 2:100105237-100105259 CCGCGGGCGGCGGACCCGGGTGG + Intronic
936171864 2:110184002-110184024 GCACTAGCGGCAGACCCAACTGG + Intronic
942268209 2:174248584-174248606 GCGACAGCGGCGGAACGGGCGGG + Exonic
1173727659 20:45308462-45308484 GGGCTAGCTGCGGGCCAGGCTGG + Intronic
1173831061 20:46089171-46089193 GCGCCAGCGTCCGATCCGGCCGG - Intronic
1175901489 20:62361584-62361606 GGGGCAGCGGCGGAGCCGGCTGG + Intronic
1176550185 21:8217408-8217430 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1176569113 21:8400446-8400468 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1176569430 21:8401998-8402020 GCGCGTGCGGGGGGCCCGGCGGG + Intergenic
1176577027 21:8444678-8444700 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1181265830 22:21630017-21630039 GCGCGAGCGGTGGACCCAGGCGG - Exonic
1182771810 22:32801794-32801816 GCGCTGGCGCAGGACTCGGCGGG - Exonic
1183586402 22:38755601-38755623 GCGCGGGCCGCGGACCCGGGTGG + Intronic
1185259695 22:49854313-49854335 GCGCTCCCGGCGGACCCGGGCGG - Intronic
1185278612 22:49960631-49960653 GCGCTAGCTGGGGAGACGGCGGG - Exonic
1203255080 22_KI270733v1_random:133746-133768 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1203263136 22_KI270733v1_random:178825-178847 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
952889138 3:38029468-38029490 GCGCGAGCGGGAGACCCTGCAGG - Intronic
953638680 3:44685482-44685504 GCGCTGGCGGCGGGGCCGGGTGG - Intergenic
956678027 3:71753681-71753703 GCGGCGGCGGCGGGCCCGGCGGG + Intronic
968787147 4:2631064-2631086 GCGCTTGCGGCGGGCCCTGCAGG - Exonic
992939512 5:81750032-81750054 GCGGGAGGGGCGGGCCCGGCGGG - Intronic
993654321 5:90558869-90558891 GCGCTCCCGGCGGTCCCCGCCGG - Exonic
994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG + Intronic
998152631 5:139765814-139765836 GCGGTGGCGGCGGACCCGGAGGG - Intergenic
998478370 5:142440682-142440704 GTGCTAGCGGCAGACCCGTCAGG - Intergenic
1004217052 6:13712197-13712219 GGGCTCGCGGCGGCCCCAGCGGG - Intergenic
1028830786 7:95324590-95324612 CAGCTAGCTGCCGACCCGGCGGG - Exonic
1036910673 8:12755064-12755086 GCGCTGACGGCGGCGCCGGCGGG - Exonic
1049585397 8:143430490-143430512 CCGCGGGCGGCGGTCCCGGCGGG + Intergenic
1053011655 9:34637193-34637215 GTGCTAGCGGCGGGCCAGACTGG - Intronic
1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1057259560 9:93576347-93576369 GCGGGAGCGGCGGCCCAGGCCGG + Intergenic
1057488937 9:95507372-95507394 GCGCTGGCCGCGGCCCCGGCGGG + Intronic
1061144131 9:128787311-128787333 GCGCAGGCGGCGGAGGCGGCTGG + Exonic
1061613285 9:131762704-131762726 GAGCCAGCGGCGGACCTCGCTGG + Intergenic
1203471478 Un_GL000220v1:116883-116905 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1203471795 Un_GL000220v1:118435-118457 GCGCGTGCGGGGGGCCCGGCGGG + Intergenic
1203479299 Un_GL000220v1:160855-160877 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1186561741 X:10620251-10620273 GCGCTGGCGGCGGAGGGGGCGGG - Intronic
1187419554 X:19122557-19122579 GAGCTGGCGGCGGAGCGGGCCGG - Exonic
1187518261 X:19991274-19991296 GCGCTCTAGCCGGACCCGGCGGG - Intergenic
1190024664 X:46912539-46912561 GCGCGGGGGGCGGCCCCGGCGGG + Exonic
1194977358 X:100408785-100408807 GAGGTTGCGGCGGACGCGGCGGG + Exonic
1200128915 X:153830658-153830680 GCGGCAGCGGCGGGCCCCGCGGG - Intergenic