ID: 1073306037

View in Genome Browser
Species Human (GRCh38)
Location 10:102504150-102504172
Sequence CTAGGCCGCAGCTCCGCCAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306037_1073306057 30 Left 1073306037 10:102504150-102504172 CCGATGGCGGAGCTGCGGCCTAG 0: 1
1: 0
2: 0
3: 12
4: 253
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306037_1073306048 13 Left 1073306037 10:102504150-102504172 CCGATGGCGGAGCTGCGGCCTAG 0: 1
1: 0
2: 0
3: 12
4: 253
Right 1073306048 10:102504186-102504208 CCCACCGCGCCCCCGGCCCCTGG 0: 1
1: 0
2: 10
3: 117
4: 919
1073306037_1073306043 6 Left 1073306037 10:102504150-102504172 CCGATGGCGGAGCTGCGGCCTAG 0: 1
1: 0
2: 0
3: 12
4: 253
Right 1073306043 10:102504179-102504201 CCCCGGCCCCACCGCGCCCCCGG 0: 1
1: 0
2: 9
3: 122
4: 894

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306037 Original CRISPR CTAGGCCGCAGCTCCGCCAT CGG (reversed) Exonic