ID: 1073306040

View in Genome Browser
Species Human (GRCh38)
Location 10:102504168-102504190
Sequence GTGGGGCCGGGGGCGCCGCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 510}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306040_1073306057 12 Left 1073306040 10:102504168-102504190 CCTAGCGGCGCCCCCGGCCCCAC 0: 1
1: 0
2: 5
3: 43
4: 510
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306040_1073306048 -5 Left 1073306040 10:102504168-102504190 CCTAGCGGCGCCCCCGGCCCCAC 0: 1
1: 0
2: 5
3: 43
4: 510
Right 1073306048 10:102504186-102504208 CCCACCGCGCCCCCGGCCCCTGG 0: 1
1: 0
2: 10
3: 117
4: 919

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306040 Original CRISPR GTGGGGCCGGGGGCGCCGCT AGG (reversed) Exonic