ID: 1073306042

View in Genome Browser
Species Human (GRCh38)
Location 10:102504179-102504201
Sequence CCGGGGGCGCGGTGGGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1115
Summary {0: 1, 1: 0, 2: 12, 3: 116, 4: 986}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306042_1073306057 1 Left 1073306042 10:102504179-102504201 CCCCGGCCCCACCGCGCCCCCGG 0: 1
1: 0
2: 12
3: 116
4: 986
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306042_1073306069 26 Left 1073306042 10:102504179-102504201 CCCCGGCCCCACCGCGCCCCCGG 0: 1
1: 0
2: 12
3: 116
4: 986
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306042_1073306068 25 Left 1073306042 10:102504179-102504201 CCCCGGCCCCACCGCGCCCCCGG 0: 1
1: 0
2: 12
3: 116
4: 986
Right 1073306068 10:102504227-102504249 CTTCGCTTCGCTCTTTCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306042 Original CRISPR CCGGGGGCGCGGTGGGGCCG GGG (reversed) Exonic