ID: 1073306044

View in Genome Browser
Species Human (GRCh38)
Location 10:102504180-102504202
Sequence GCCGGGGGCGCGGTGGGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1346
Summary {0: 1, 1: 0, 2: 19, 3: 183, 4: 1143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306044_1073306057 0 Left 1073306044 10:102504180-102504202 CCCGGCCCCACCGCGCCCCCGGC 0: 1
1: 0
2: 19
3: 183
4: 1143
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306044_1073306068 24 Left 1073306044 10:102504180-102504202 CCCGGCCCCACCGCGCCCCCGGC 0: 1
1: 0
2: 19
3: 183
4: 1143
Right 1073306068 10:102504227-102504249 CTTCGCTTCGCTCTTTCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 119
1073306044_1073306069 25 Left 1073306044 10:102504180-102504202 CCCGGCCCCACCGCGCCCCCGGC 0: 1
1: 0
2: 19
3: 183
4: 1143
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306044 Original CRISPR GCCGGGGGCGCGGTGGGGCC GGG (reversed) Exonic