ID: 1073306046

View in Genome Browser
Species Human (GRCh38)
Location 10:102504185-102504207
Sequence CAGGGGCCGGGGGCGCGGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1127
Summary {0: 1, 1: 1, 2: 5, 3: 122, 4: 998}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306046_1073306068 19 Left 1073306046 10:102504185-102504207 CCCCACCGCGCCCCCGGCCCCTG 0: 1
1: 1
2: 5
3: 122
4: 998
Right 1073306068 10:102504227-102504249 CTTCGCTTCGCTCTTTCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 119
1073306046_1073306069 20 Left 1073306046 10:102504185-102504207 CCCCACCGCGCCCCCGGCCCCTG 0: 1
1: 1
2: 5
3: 122
4: 998
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306046_1073306057 -5 Left 1073306046 10:102504185-102504207 CCCCACCGCGCCCCCGGCCCCTG 0: 1
1: 1
2: 5
3: 122
4: 998
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306046 Original CRISPR CAGGGGCCGGGGGCGCGGTG GGG (reversed) Exonic