ID: 1073306049

View in Genome Browser
Species Human (GRCh38)
Location 10:102504187-102504209
Sequence GCCAGGGGCCGGGGGCGCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1524
Summary {0: 1, 1: 0, 2: 10, 3: 182, 4: 1331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306049_1073306069 18 Left 1073306049 10:102504187-102504209 CCACCGCGCCCCCGGCCCCTGGC 0: 1
1: 0
2: 10
3: 182
4: 1331
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306049_1073306057 -7 Left 1073306049 10:102504187-102504209 CCACCGCGCCCCCGGCCCCTGGC 0: 1
1: 0
2: 10
3: 182
4: 1331
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306049_1073306068 17 Left 1073306049 10:102504187-102504209 CCACCGCGCCCCCGGCCCCTGGC 0: 1
1: 0
2: 10
3: 182
4: 1331
Right 1073306068 10:102504227-102504249 CTTCGCTTCGCTCTTTCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306049 Original CRISPR GCCAGGGGCCGGGGGCGCGG TGG (reversed) Exonic