ID: 1073306050

View in Genome Browser
Species Human (GRCh38)
Location 10:102504190-102504212
Sequence CGGGCCAGGGGCCGGGGGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2346
Summary {0: 1, 1: 1, 2: 24, 3: 364, 4: 1956}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306050_1073306069 15 Left 1073306050 10:102504190-102504212 CCGCGCCCCCGGCCCCTGGCCCG 0: 1
1: 1
2: 24
3: 364
4: 1956
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306050_1073306068 14 Left 1073306050 10:102504190-102504212 CCGCGCCCCCGGCCCCTGGCCCG 0: 1
1: 1
2: 24
3: 364
4: 1956
Right 1073306068 10:102504227-102504249 CTTCGCTTCGCTCTTTCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 119
1073306050_1073306057 -10 Left 1073306050 10:102504190-102504212 CCGCGCCCCCGGCCCCTGGCCCG 0: 1
1: 1
2: 24
3: 364
4: 1956
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306050 Original CRISPR CGGGCCAGGGGCCGGGGGCG CGG (reversed) Exonic