ID: 1073306052

View in Genome Browser
Species Human (GRCh38)
Location 10:102504196-102504218
Sequence GGCAGTCGGGCCAGGGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 604}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306052_1073306068 8 Left 1073306052 10:102504196-102504218 CCCCGGCCCCTGGCCCGACTGCC 0: 1
1: 0
2: 2
3: 54
4: 604
Right 1073306068 10:102504227-102504249 CTTCGCTTCGCTCTTTCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 119
1073306052_1073306069 9 Left 1073306052 10:102504196-102504218 CCCCGGCCCCTGGCCCGACTGCC 0: 1
1: 0
2: 2
3: 54
4: 604
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306052_1073306074 27 Left 1073306052 10:102504196-102504218 CCCCGGCCCCTGGCCCGACTGCC 0: 1
1: 0
2: 2
3: 54
4: 604
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306052 Original CRISPR GGCAGTCGGGCCAGGGGCCG GGG (reversed) Exonic