ID: 1073306053

View in Genome Browser
Species Human (GRCh38)
Location 10:102504197-102504219
Sequence GGGCAGTCGGGCCAGGGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 749
Summary {0: 1, 1: 0, 2: 14, 3: 73, 4: 661}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306053_1073306074 26 Left 1073306053 10:102504197-102504219 CCCGGCCCCTGGCCCGACTGCCC 0: 1
1: 0
2: 14
3: 73
4: 661
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306053_1073306068 7 Left 1073306053 10:102504197-102504219 CCCGGCCCCTGGCCCGACTGCCC 0: 1
1: 0
2: 14
3: 73
4: 661
Right 1073306068 10:102504227-102504249 CTTCGCTTCGCTCTTTCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 119
1073306053_1073306069 8 Left 1073306053 10:102504197-102504219 CCCGGCCCCTGGCCCGACTGCCC 0: 1
1: 0
2: 14
3: 73
4: 661
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306053 Original CRISPR GGGCAGTCGGGCCAGGGGCC GGG (reversed) Exonic