ID: 1073306054

View in Genome Browser
Species Human (GRCh38)
Location 10:102504198-102504220
Sequence GGGGCAGTCGGGCCAGGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 833
Summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 758}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306054_1073306074 25 Left 1073306054 10:102504198-102504220 CCGGCCCCTGGCCCGACTGCCCC 0: 1
1: 0
2: 4
3: 70
4: 758
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306054_1073306069 7 Left 1073306054 10:102504198-102504220 CCGGCCCCTGGCCCGACTGCCCC 0: 1
1: 0
2: 4
3: 70
4: 758
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306054_1073306068 6 Left 1073306054 10:102504198-102504220 CCGGCCCCTGGCCCGACTGCCCC 0: 1
1: 0
2: 4
3: 70
4: 758
Right 1073306068 10:102504227-102504249 CTTCGCTTCGCTCTTTCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306054 Original CRISPR GGGGCAGTCGGGCCAGGGGC CGG (reversed) Exonic