ID: 1073306057

View in Genome Browser
Species Human (GRCh38)
Location 10:102504203-102504225
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 342}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306040_1073306057 12 Left 1073306040 10:102504168-102504190 CCTAGCGGCGCCCCCGGCCCCAC 0: 1
1: 0
2: 5
3: 43
4: 510
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306044_1073306057 0 Left 1073306044 10:102504180-102504202 CCCGGCCCCACCGCGCCCCCGGC 0: 1
1: 0
2: 19
3: 183
4: 1143
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306041_1073306057 2 Left 1073306041 10:102504178-102504200 CCCCCGGCCCCACCGCGCCCCCG 0: 1
1: 0
2: 11
3: 135
4: 1249
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306049_1073306057 -7 Left 1073306049 10:102504187-102504209 CCACCGCGCCCCCGGCCCCTGGC 0: 1
1: 0
2: 10
3: 182
4: 1331
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306046_1073306057 -5 Left 1073306046 10:102504185-102504207 CCCCACCGCGCCCCCGGCCCCTG 0: 1
1: 1
2: 5
3: 122
4: 998
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306037_1073306057 30 Left 1073306037 10:102504150-102504172 CCGATGGCGGAGCTGCGGCCTAG 0: 1
1: 0
2: 0
3: 12
4: 253
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306050_1073306057 -10 Left 1073306050 10:102504190-102504212 CCGCGCCCCCGGCCCCTGGCCCG 0: 1
1: 1
2: 24
3: 364
4: 1956
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306042_1073306057 1 Left 1073306042 10:102504179-102504201 CCCCGGCCCCACCGCGCCCCCGG 0: 1
1: 0
2: 12
3: 116
4: 986
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306045_1073306057 -1 Left 1073306045 10:102504181-102504203 CCGGCCCCACCGCGCCCCCGGCC 0: 1
1: 2
2: 27
3: 259
4: 1897
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342
1073306047_1073306057 -6 Left 1073306047 10:102504186-102504208 CCCACCGCGCCCCCGGCCCCTGG 0: 1
1: 0
2: 3
3: 56
4: 670
Right 1073306057 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type