ID: 1073306058

View in Genome Browser
Species Human (GRCh38)
Location 10:102504204-102504226
Sequence GCCGGGGGGGCAGTCGGGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306058_1073306068 0 Left 1073306058 10:102504204-102504226 CCTGGCCCGACTGCCCCCCCGGC 0: 1
1: 0
2: 2
3: 35
4: 416
Right 1073306068 10:102504227-102504249 CTTCGCTTCGCTCTTTCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 119
1073306058_1073306069 1 Left 1073306058 10:102504204-102504226 CCTGGCCCGACTGCCCCCCCGGC 0: 1
1: 0
2: 2
3: 35
4: 416
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306058_1073306074 19 Left 1073306058 10:102504204-102504226 CCTGGCCCGACTGCCCCCCCGGC 0: 1
1: 0
2: 2
3: 35
4: 416
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306058 Original CRISPR GCCGGGGGGGCAGTCGGGCC AGG (reversed) Exonic