ID: 1073306059

View in Genome Browser
Species Human (GRCh38)
Location 10:102504209-102504231
Sequence CGAAGGCCGGGGGGGCAGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306059_1073306069 -4 Left 1073306059 10:102504209-102504231 CCCGACTGCCCCCCCGGCCTTCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306059_1073306074 14 Left 1073306059 10:102504209-102504231 CCCGACTGCCCCCCCGGCCTTCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306059_1073306068 -5 Left 1073306059 10:102504209-102504231 CCCGACTGCCCCCCCGGCCTTCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1073306068 10:102504227-102504249 CTTCGCTTCGCTCTTTCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306059 Original CRISPR CGAAGGCCGGGGGGGCAGTC GGG (reversed) Exonic