ID: 1073306061 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:102504217-102504239 |
| Sequence | GAGCGAAGCGAAGGCCGGGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 225 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 22, 4: 201} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1073306061_1073306074 | 6 | Left | 1073306061 | 10:102504217-102504239 | CCCCCCCGGCCTTCGCTTCGCTC | 0: 1 1: 0 2: 1 3: 22 4: 201 |
||
| Right | 1073306074 | 10:102504246-102504268 | CCGGGACTGCACGCCATCTACGG | 0: 1 1: 0 2: 0 3: 2 4: 38 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1073306061 | Original CRISPR | GAGCGAAGCGAAGGCCGGGG GGG (reversed) | Exonic | ||