ID: 1073306069

View in Genome Browser
Species Human (GRCh38)
Location 10:102504228-102504250
Sequence TTCGCTTCGCTCTTTCCCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 186}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306050_1073306069 15 Left 1073306050 10:102504190-102504212 CCGCGCCCCCGGCCCCTGGCCCG 0: 1
1: 1
2: 24
3: 364
4: 1956
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306047_1073306069 19 Left 1073306047 10:102504186-102504208 CCCACCGCGCCCCCGGCCCCTGG 0: 1
1: 0
2: 3
3: 56
4: 670
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306049_1073306069 18 Left 1073306049 10:102504187-102504209 CCACCGCGCCCCCGGCCCCTGGC 0: 1
1: 0
2: 10
3: 182
4: 1331
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306045_1073306069 24 Left 1073306045 10:102504181-102504203 CCGGCCCCACCGCGCCCCCGGCC 0: 1
1: 2
2: 27
3: 259
4: 1897
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306041_1073306069 27 Left 1073306041 10:102504178-102504200 CCCCCGGCCCCACCGCGCCCCCG 0: 1
1: 0
2: 11
3: 135
4: 1249
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306056_1073306069 2 Left 1073306056 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306042_1073306069 26 Left 1073306042 10:102504179-102504201 CCCCGGCCCCACCGCGCCCCCGG 0: 1
1: 0
2: 12
3: 116
4: 986
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306054_1073306069 7 Left 1073306054 10:102504198-102504220 CCGGCCCCTGGCCCGACTGCCCC 0: 1
1: 0
2: 4
3: 70
4: 758
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306060_1073306069 -5 Left 1073306060 10:102504210-102504232 CCGACTGCCCCCCCGGCCTTCGC 0: 1
1: 0
2: 0
3: 10
4: 239
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306053_1073306069 8 Left 1073306053 10:102504197-102504219 CCCGGCCCCTGGCCCGACTGCCC 0: 1
1: 0
2: 14
3: 73
4: 661
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306052_1073306069 9 Left 1073306052 10:102504196-102504218 CCCCGGCCCCTGGCCCGACTGCC 0: 1
1: 0
2: 2
3: 54
4: 604
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306059_1073306069 -4 Left 1073306059 10:102504209-102504231 CCCGACTGCCCCCCCGGCCTTCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306051_1073306069 10 Left 1073306051 10:102504195-102504217 CCCCCGGCCCCTGGCCCGACTGC 0: 1
1: 0
2: 2
3: 38
4: 337
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306058_1073306069 1 Left 1073306058 10:102504204-102504226 CCTGGCCCGACTGCCCCCCCGGC 0: 1
1: 0
2: 2
3: 35
4: 416
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306055_1073306069 3 Left 1073306055 10:102504202-102504224 CCCCTGGCCCGACTGCCCCCCCG 0: 1
1: 0
2: 2
3: 22
4: 263
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306046_1073306069 20 Left 1073306046 10:102504185-102504207 CCCCACCGCGCCCCCGGCCCCTG 0: 1
1: 1
2: 5
3: 122
4: 998
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186
1073306044_1073306069 25 Left 1073306044 10:102504180-102504202 CCCGGCCCCACCGCGCCCCCGGC 0: 1
1: 0
2: 19
3: 183
4: 1143
Right 1073306069 10:102504228-102504250 TTCGCTTCGCTCTTTCCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306069 Original CRISPR TTCGCTTCGCTCTTTCCCCC GGG Exonic