ID: 1073306074

View in Genome Browser
Species Human (GRCh38)
Location 10:102504246-102504268
Sequence CCGGGACTGCACGCCATCTA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073306060_1073306074 13 Left 1073306060 10:102504210-102504232 CCGACTGCCCCCCCGGCCTTCGC 0: 1
1: 0
2: 0
3: 10
4: 239
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306056_1073306074 20 Left 1073306056 10:102504203-102504225 CCCTGGCCCGACTGCCCCCCCGG 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306053_1073306074 26 Left 1073306053 10:102504197-102504219 CCCGGCCCCTGGCCCGACTGCCC 0: 1
1: 0
2: 14
3: 73
4: 661
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306062_1073306074 5 Left 1073306062 10:102504218-102504240 CCCCCCGGCCTTCGCTTCGCTCT 0: 1
1: 0
2: 1
3: 6
4: 129
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306067_1073306074 -3 Left 1073306067 10:102504226-102504248 CCTTCGCTTCGCTCTTTCCCCCG 0: 1
1: 0
2: 0
3: 6
4: 135
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306064_1073306074 3 Left 1073306064 10:102504220-102504242 CCCCGGCCTTCGCTTCGCTCTTT 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306063_1073306074 4 Left 1073306063 10:102504219-102504241 CCCCCGGCCTTCGCTTCGCTCTT 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306051_1073306074 28 Left 1073306051 10:102504195-102504217 CCCCCGGCCCCTGGCCCGACTGC 0: 1
1: 0
2: 2
3: 38
4: 337
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306065_1073306074 2 Left 1073306065 10:102504221-102504243 CCCGGCCTTCGCTTCGCTCTTTC 0: 1
1: 0
2: 0
3: 13
4: 208
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306054_1073306074 25 Left 1073306054 10:102504198-102504220 CCGGCCCCTGGCCCGACTGCCCC 0: 1
1: 0
2: 4
3: 70
4: 758
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306052_1073306074 27 Left 1073306052 10:102504196-102504218 CCCCGGCCCCTGGCCCGACTGCC 0: 1
1: 0
2: 2
3: 54
4: 604
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306059_1073306074 14 Left 1073306059 10:102504209-102504231 CCCGACTGCCCCCCCGGCCTTCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306055_1073306074 21 Left 1073306055 10:102504202-102504224 CCCCTGGCCCGACTGCCCCCCCG 0: 1
1: 0
2: 2
3: 22
4: 263
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306061_1073306074 6 Left 1073306061 10:102504217-102504239 CCCCCCCGGCCTTCGCTTCGCTC 0: 1
1: 0
2: 1
3: 22
4: 201
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306058_1073306074 19 Left 1073306058 10:102504204-102504226 CCTGGCCCGACTGCCCCCCCGGC 0: 1
1: 0
2: 2
3: 35
4: 416
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1073306066_1073306074 1 Left 1073306066 10:102504222-102504244 CCGGCCTTCGCTTCGCTCTTTCC 0: 1
1: 0
2: 0
3: 25
4: 364
Right 1073306074 10:102504246-102504268 CCGGGACTGCACGCCATCTACGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073306074 Original CRISPR CCGGGACTGCACGCCATCTA CGG Exonic