ID: 1073315371

View in Genome Browser
Species Human (GRCh38)
Location 10:102577028-102577050
Sequence TGGTCTCTTCAGGAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073315367_1073315371 10 Left 1073315367 10:102576995-102577017 CCAGTCTAAATGGGTTTTCATTC 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1073315371 10:102577028-102577050 TGGTCTCTTCAGGAAGAAGATGG No data
1073315366_1073315371 11 Left 1073315366 10:102576994-102577016 CCCAGTCTAAATGGGTTTTCATT 0: 1
1: 0
2: 0
3: 18
4: 235
Right 1073315371 10:102577028-102577050 TGGTCTCTTCAGGAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073315371 Original CRISPR TGGTCTCTTCAGGAAGAAGA TGG Intronic
No off target data available for this crispr