ID: 1073318109

View in Genome Browser
Species Human (GRCh38)
Location 10:102597055-102597077
Sequence CTGTAAGAGCAGTGGCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 2, 2: 1, 3: 15, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073318102_1073318109 21 Left 1073318102 10:102597011-102597033 CCAGCATTTGTCCCATGCTCAGC 0: 1
1: 0
2: 1
3: 10
4: 172
Right 1073318109 10:102597055-102597077 CTGTAAGAGCAGTGGCTGAAAGG 0: 1
1: 2
2: 1
3: 15
4: 197
1073318106_1073318109 9 Left 1073318106 10:102597023-102597045 CCATGCTCAGCACCACAAGGGCT 0: 1
1: 0
2: 2
3: 27
4: 243
Right 1073318109 10:102597055-102597077 CTGTAAGAGCAGTGGCTGAAAGG 0: 1
1: 2
2: 1
3: 15
4: 197
1073318107_1073318109 -3 Left 1073318107 10:102597035-102597057 CCACAAGGGCTCAGTAAATACTG 0: 1
1: 0
2: 1
3: 7
4: 150
Right 1073318109 10:102597055-102597077 CTGTAAGAGCAGTGGCTGAAAGG 0: 1
1: 2
2: 1
3: 15
4: 197
1073318105_1073318109 10 Left 1073318105 10:102597022-102597044 CCCATGCTCAGCACCACAAGGGC 0: 1
1: 0
2: 2
3: 8
4: 196
Right 1073318109 10:102597055-102597077 CTGTAAGAGCAGTGGCTGAAAGG 0: 1
1: 2
2: 1
3: 15
4: 197
1073318101_1073318109 29 Left 1073318101 10:102597003-102597025 CCTGCTCTCCAGCATTTGTCCCA 0: 1
1: 0
2: 2
3: 23
4: 402
Right 1073318109 10:102597055-102597077 CTGTAAGAGCAGTGGCTGAAAGG 0: 1
1: 2
2: 1
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073318109 Original CRISPR CTGTAAGAGCAGTGGCTGAA AGG Intronic
900856417 1:5188779-5188801 GTGTCAGAGCAGTGGGTGAAAGG - Intergenic
901689192 1:10961385-10961407 CTGAAGGAGCAGGGGCTGAGCGG - Intronic
903183887 1:21618909-21618931 CTGTAAGACTACTTGCTGAAAGG + Intronic
904676762 1:32203632-32203654 CAGCCAGAGCAGTGCCTGAAAGG - Intronic
906383672 1:45348787-45348809 CTGTAAGAGGAGTGGCATAGAGG - Intronic
906590381 1:47019520-47019542 CTGTTTCAGCATTGGCTGAATGG - Intergenic
906683914 1:47750393-47750415 CTGTCAGAGCAGAAGCTGCAAGG - Intergenic
909694966 1:78457057-78457079 CTGAGAGAGCTGTGGCTGATGGG - Intronic
910369907 1:86504277-86504299 GTGTAAGCGCAGAGGCTGGAGGG - Intergenic
913221830 1:116666672-116666694 CTGTATAATCAGTGGATGAAAGG - Exonic
913482619 1:119303499-119303521 CTGGATGAGCTGTGCCTGAAAGG - Intergenic
916318743 1:163479564-163479586 CTGCTACAGCTGTGGCTGAAAGG + Intergenic
916683663 1:167126179-167126201 CTGTACGAGCAGTGGAAGAAGGG + Exonic
918119861 1:181529148-181529170 CTGTTCCAGCTGTGGCTGAAAGG + Intronic
918350268 1:183648113-183648135 CTGGGAGAGCACTGGCTGACAGG - Exonic
922975536 1:229780535-229780557 CTGTAAGAGGTTTGTCTGAATGG - Intergenic
923363595 1:233236881-233236903 CAGTAACAGCTGTTGCTGAAGGG + Exonic
924583677 1:245343410-245343432 CTGGCAGAGCAGAGGCAGAATGG - Intronic
924669153 1:246105473-246105495 TTGTATGAGTTGTGGCTGAAGGG - Intronic
1065851647 10:29795108-29795130 ATGTAAGAGAAGTGATTGAATGG - Intergenic
1066019372 10:31282584-31282606 GTGTAAGGGTAATGGCTGAATGG + Intergenic
1066636838 10:37511625-37511647 CTGTAGGAGCAGTGTCCCAATGG + Intergenic
1070513773 10:77184735-77184757 CTGCGAGAGCAGAGGCTGAGGGG + Intronic
1071883993 10:89929866-89929888 CTGTAGGATCAGTGGTTGAATGG + Intergenic
1073318109 10:102597055-102597077 CTGTAAGAGCAGTGGCTGAAAGG + Intronic
1074233770 10:111564140-111564162 CTGGAAGGGCAGTGGGTCAAAGG + Intergenic
1074756780 10:116629634-116629656 CTCTGAGAGCAGTGGCCAAATGG + Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075544539 10:123345014-123345036 CAGTAAAAGCAGTGGCTGGGAGG - Intergenic
1075559860 10:123460569-123460591 GTGGAAGAGCAGGGGCTGCACGG - Intergenic
1077010899 11:378880-378902 CTGGAAGAGGAGTGGCTGGGAGG + Intronic
1078482193 11:11687408-11687430 CTGCACCAGCCGTGGCTGAAGGG + Intergenic
1078900692 11:15639696-15639718 CTGTAATAGCAGTGGCTCCAAGG - Intergenic
1079343180 11:19629808-19629830 CTGTGAGAGCAGAGGTTGAGAGG - Intronic
1079838679 11:25366993-25367015 CTGCTCCAGCAGTGGCTGAAAGG - Intergenic
1081508059 11:43738738-43738760 CTGTAAGAGCAGGGTCTGTCTGG - Intronic
1083546965 11:63556079-63556101 CTATTAGAGCAGGGGCTGGATGG + Intronic
1084939275 11:72603695-72603717 CTGTAAGAGGATGGTCTGAAAGG - Intronic
1085390523 11:76179707-76179729 GTGTAAGAGCTGAGGCTAAATGG - Intergenic
1085739524 11:79067033-79067055 CAGCCAGAGCAGAGGCTGAAAGG - Intronic
1087386255 11:97472055-97472077 CTGGATGAGATGTGGCTGAAGGG + Intergenic
1088497056 11:110441968-110441990 CTGTCCCAGCTGTGGCTGAAAGG + Intronic
1091040828 11:132279629-132279651 CTGGAAGATCAATGGCGGAAAGG - Intronic
1091413648 12:261386-261408 CTGAAAGAGCAGGGGCAGAGTGG - Intronic
1095380273 12:41582543-41582565 CTGTAAAAGCAATAGCTAAATGG - Intergenic
1095509522 12:42935207-42935229 CTGCACGAGCGATGGCTGAAGGG + Intergenic
1095762009 12:45850472-45850494 CTGTAACAGGAGTGCCTGAAGGG - Exonic
1096554131 12:52393081-52393103 CTGTATGGACAGGGGCTGAAGGG - Intergenic
1096900422 12:54873202-54873224 CTGAAAAGGCAGTGGCTGAATGG + Intergenic
1096988174 12:55775918-55775940 ATGTGAGAGCAATGGCAGAATGG - Intronic
1103154094 12:118668350-118668372 TTTAAAGAGCTGTGGCTGAAAGG + Intergenic
1103359923 12:120347500-120347522 CAGTGAGAGGAATGGCTGAAAGG + Exonic
1106587755 13:31072117-31072139 CTGTGAGAGAATAGGCTGAAGGG - Intergenic
1108240042 13:48454802-48454824 CAGCAAGTGCAGTGGCTGTAGGG + Intronic
1110184302 13:72655540-72655562 CACTTAGAGCAGTGCCTGAAAGG - Intergenic
1110806155 13:79756717-79756739 CTGTTCCAGCTGTGGCTGAAAGG - Intergenic
1111188738 13:84780253-84780275 CTGCAAGAGAAGTGGCTTCAGGG - Intergenic
1112803634 13:103138556-103138578 ATGTAAAAGCAGTGGCAGAGAGG + Intergenic
1114059009 14:19001989-19002011 CTGCAAAGGCAGTGGCAGAAAGG - Intergenic
1114103534 14:19399765-19399787 CTGCAAAGGCAGTGGCAGAAAGG + Intergenic
1115093835 14:29610975-29610997 CAGAAAGATCAGTGGCTGACAGG + Intronic
1118660523 14:68004751-68004773 CAGAAAAGGCAGTGGCTGAAAGG - Intronic
1118730706 14:68664333-68664355 CTGTAAGGGCAGAGGTTAAAAGG - Intronic
1118789093 14:69072677-69072699 CTGTAAGAATAGTGGCAGAAGGG + Intronic
1118914776 14:70093767-70093789 CTCTCTGAGCAGTGGCAGAATGG - Intronic
1119678956 14:76577589-76577611 CTGTTAGAGAGGTGGCTGCAGGG + Intergenic
1124610006 15:31201695-31201717 GTGTAGGAGGAGTGGCTGAGGGG - Intergenic
1125704370 15:41720125-41720147 CTTGAAGAACAGTGGCAGAATGG + Intronic
1125786351 15:42321857-42321879 ATGTAAAAGCAGTGGATGCAGGG + Exonic
1126887375 15:53165180-53165202 CTGAAAGAGTGGTGGGTGAAAGG + Intergenic
1126910040 15:53408215-53408237 CTTTTAGTGCAGTGGGTGAATGG - Intergenic
1128685747 15:69684252-69684274 CTGTCAGAGCAATAGCTGCAAGG - Intergenic
1129172319 15:73815792-73815814 CTGGAGGAGCAGGGGCAGAAAGG - Intergenic
1132828187 16:1915185-1915207 TTGCAAGAGCAGTGGGTGCAGGG - Intronic
1133770328 16:8863902-8863924 CTGGGAGAGCAGTGGCTGGCTGG - Intronic
1133971939 16:10574495-10574517 CTGGAGGAGCAGTGGGTGCATGG - Intronic
1136512035 16:30744012-30744034 CTGTGACAGCAGTGGTTGGAAGG + Intronic
1138054197 16:53815259-53815281 CCGTTAGAGAAGAGGCTGAATGG - Intronic
1138192955 16:55031598-55031620 CTGTCATAGCACTTGCTGAATGG - Intergenic
1140239946 16:73191680-73191702 CTGAAAGAGCCGTGGGTGAGAGG - Intergenic
1141019958 16:80485679-80485701 CTGGGAGAGCAGTGGCTGGAGGG + Intergenic
1143837307 17:9702542-9702564 ATTTCAGAGCAGTGGATGAAGGG + Intronic
1146421960 17:32695287-32695309 CTGTAAGATCAGTGGCTCATTGG - Intronic
1148713757 17:49700687-49700709 TTGATAGAGCTGTGGCTGAAGGG + Intergenic
1149017138 17:51921156-51921178 CTGTATGAGCAGTGGTTAGATGG - Intronic
1150327751 17:64270219-64270241 CTGCCACAGCAGTGGCTGGAAGG + Intergenic
1150666062 17:67139741-67139763 CTGTAAGAGCTGTGGGGGAAAGG - Intronic
1152829423 17:82488047-82488069 CTGTACCAGGAGTGGCTGGAGGG + Exonic
1156701468 18:39830561-39830583 CTTTAAGAGCATTGGCTCAGGGG - Intergenic
1159083418 18:63760689-63760711 CTGCTCCAGCAGTGGCTGAAAGG + Intronic
1162410185 19:10501104-10501126 CAGTAAGTGCAGTGGCTCAGAGG + Intronic
1166689657 19:44814759-44814781 CTGTGAGAGCCCTGGGTGAACGG + Exonic
925719167 2:6811492-6811514 GTGTGAGAGCAGGGGCTGCACGG + Intergenic
929094412 2:38249890-38249912 GTGTAAAAGCAGTGGATGACTGG - Intergenic
929798998 2:45083473-45083495 CAGCAAGAGCAGTGGGTGAAGGG - Intergenic
933688944 2:85164310-85164332 CAGTGGCAGCAGTGGCTGAAGGG + Intronic
934987602 2:98899207-98899229 CTGGCAGAGGAGTGGCTGCAGGG - Intronic
935548484 2:104425975-104425997 ATGTAAGAGCAGAGCCTGCAGGG + Intergenic
935631415 2:105215585-105215607 CAGTAAGAGCAGAGGCTACAAGG - Intergenic
935733296 2:106084386-106084408 CTGCAAGGGCAGTGGTTGAGTGG - Intergenic
937799106 2:126060702-126060724 CTGTGAGAGGAGTGGCTAGAGGG - Intergenic
938582322 2:132657950-132657972 CTGTAAGGGTAGTGACTGAGTGG - Intronic
939600088 2:144178070-144178092 CTGTACGAGCACTGGATAAACGG - Intronic
940408769 2:153335936-153335958 CTGTGCCAGCTGTGGCTGAAAGG + Intergenic
940446827 2:153786221-153786243 CTGTAACTGCAGTGCCAGAAGGG - Intergenic
941184941 2:162310003-162310025 CTGTAAGAGTTTTGGGTGAATGG - Intronic
943662125 2:190570481-190570503 ATGTAAGAGCAAAAGCTGAAAGG - Intergenic
943988710 2:194657926-194657948 CTGAAAAAGCAGTCACTGAAAGG + Intergenic
945998761 2:216463173-216463195 CTGTAAGATCTGTGACTGACAGG - Intronic
946977573 2:225170254-225170276 TTCTAAGAGCAGTGGCTCCAAGG + Intergenic
948217715 2:236244241-236244263 CTATATGAGCAGAGGCTGGAGGG + Intronic
1169318230 20:4610597-4610619 CTGGAGGAGCAGTGGGTGCAGGG - Intergenic
1169889634 20:10438393-10438415 CTGGAAGAGGAGTGGCTGGAGGG - Intronic
1172468686 20:35175335-35175357 TTGTATGAGAAGTGGCTGGAGGG - Intronic
1173998826 20:47359546-47359568 CTTTAAGAGGAGCTGCTGAATGG - Intergenic
1175993027 20:62798841-62798863 GTTTGAGAGCAGTGGCTGGACGG + Intronic
1179585368 21:42370942-42370964 GTGTGTGAGCAGTGGCTGGAGGG - Intergenic
1180140993 21:45893281-45893303 CTGTCACAGCAGGGGCTGGAGGG + Intronic
1180176900 21:46095221-46095243 CTGTTAGAGAAGGGGCTGACGGG - Intergenic
1180220127 21:46353265-46353287 CTGTTACAGCAGAGGCTGCAGGG + Exonic
1180477493 22:15724605-15724627 CTGCAAAGGCAGTGGCAGAAAGG - Intergenic
1180666736 22:17519229-17519251 GTGGAGGAGCAGTGGCTGCACGG - Intronic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1184780503 22:46646700-46646722 CTGTAAGAGCAGAGTTTAAAAGG - Intronic
949101707 3:153469-153491 CTGTAGGAAAAGTGGCTTAAAGG - Intergenic
949260805 3:2100182-2100204 TTGTAAGAGGAGTTCCTGAAAGG + Intronic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
950707451 3:14791830-14791852 CTGGAGGAGCAGGGGATGAATGG + Intergenic
951146119 3:19229522-19229544 CTGATCCAGCAGTGGCTGAAAGG - Intronic
953223419 3:40995707-40995729 CTGTAATAGGATTTGCTGAAAGG - Intergenic
953466233 3:43122242-43122264 CTGCAAGAGCACTGGCCCAATGG + Intergenic
959104589 3:102051609-102051631 CTGCTCCAGCAGTGGCTGAAAGG + Intergenic
960156297 3:114299968-114299990 CTCTCAGAGCAGTGGCTTAAGGG - Intronic
961216558 3:125164739-125164761 CTGCATGAGTAGAGGCTGAAAGG + Intronic
961415675 3:126754895-126754917 CAGGAAGGGCAGTGGCTGCAAGG + Intronic
961863486 3:129936833-129936855 CGGCAAGAGCAGCGGCTCAAGGG + Intergenic
961901767 3:130219939-130219961 CTATATGAGCAGGTGCTGAAGGG + Intergenic
965203660 3:165692964-165692986 CTGCTCTAGCAGTGGCTGAAAGG - Intergenic
967817086 3:193808753-193808775 GTGGAAGAGAAGGGGCTGAAAGG - Intergenic
969037342 4:4265339-4265361 CTGTAAGTGCAGTTGCTCCAGGG - Intergenic
972883737 4:43458604-43458626 CTGACAGAGCAGAGGCAGAAAGG - Intergenic
972934204 4:44112147-44112169 CTGAAAGACCAGTGGGTCAATGG - Intergenic
974271020 4:59651697-59651719 CTGCTAGAGCAGTTGCAGAAAGG + Intergenic
974666334 4:64967517-64967539 CAGTAATAGCAGAGGGTGAAAGG - Intergenic
975273782 4:72470208-72470230 AAGTAAGAGGAGTTGCTGAAAGG - Intronic
977417302 4:96749471-96749493 CTGCTCCAGCAGTGGCTGAAAGG - Intergenic
978730779 4:112024212-112024234 CTGAAATAGCAGTGGCTGAAAGG + Intergenic
981582035 4:146259369-146259391 CTTTAAGATCCTTGGCTGAAAGG - Intronic
982519158 4:156391393-156391415 CTGTAACAACAATGGCTGATGGG + Intergenic
985429803 4:189868188-189868210 CTGTAAGGGAAGTGGCTGGATGG + Intergenic
986312522 5:6563810-6563832 ATGAAAGATCATTGGCTGAAGGG - Intergenic
988275192 5:29071849-29071871 TTGTAAGAACAGGGGCGGAAGGG + Intergenic
989735965 5:44706818-44706840 CTTTATGAACAGTAGCTGAATGG + Intergenic
993238276 5:85344683-85344705 GTGTCTGAGCAGTGGCTAAAAGG + Intergenic
993962346 5:94314873-94314895 ATGTAAGAACAGAAGCTGAAGGG - Intronic
998813952 5:145993644-145993666 CTGCTACAGCTGTGGCTGAAAGG - Intronic
998816356 5:146017894-146017916 GGGGAAGAGAAGTGGCTGAAAGG - Intronic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1000294476 5:159901303-159901325 CTGGAAGAGCAAAGGGTGAAGGG - Intergenic
1000413044 5:160954219-160954241 CTCTAAGGGCAGTAGGTGAAAGG + Intergenic
1001092885 5:168754237-168754259 CTGTATGGTCAGTGGATGAATGG + Intronic
1001425776 5:171621392-171621414 ATGGATGAGCAGTGGATGAATGG + Intergenic
1001789633 5:174444897-174444919 CTGGAAGAGCAGTGGCTCCTGGG + Intergenic
1002644902 5:180648304-180648326 CTGTATGTCCACTGGCTGAAGGG - Intronic
1004375698 6:15088991-15089013 CAGCAAGAGCAGTGGATTAATGG - Intergenic
1004706206 6:18126138-18126160 CTGGCTGAGCAGTGGCTCAAGGG + Intergenic
1005416821 6:25608679-25608701 CTGTCAGAGCTGTGGCGGAGAGG - Intronic
1007627494 6:43254713-43254735 CTGTAAGAAAAGTGGGTGAAGGG - Intronic
1007977550 6:46116834-46116856 ATGCAGGAGCAGTGGATGAAGGG - Intergenic
1008211451 6:48729604-48729626 CTGTAAAGGCAGTGGCAGAGAGG - Intergenic
1009305616 6:62085953-62085975 AGTTAAGAGGAGTGGCTGAAGGG + Intronic
1011059190 6:83244122-83244144 CTTAAAGAGCACTGGCAGAAAGG + Intronic
1012196019 6:96342170-96342192 CTGCTCCAGCAGTGGCTGAAAGG - Intergenic
1012571510 6:100735851-100735873 ATGTAAGCTCAGGGGCTGAAGGG - Intronic
1014771774 6:125465568-125465590 CTGTGCCAGCTGTGGCTGAAAGG + Intergenic
1017237626 6:152133139-152133161 TTGTAAGAGCAGTGGCTGAAAGG + Intronic
1020686119 7:11297732-11297754 ATGGAAGAGATGTGGCTGAAAGG + Intergenic
1021308796 7:19065654-19065676 CTGGAGCAGCAGTGGCTCAAAGG + Intronic
1022646174 7:32230377-32230399 CAGTAGGAGTAGGGGCTGAACGG - Intronic
1027624737 7:80531960-80531982 CTGTTCTAGCTGTGGCTGAAAGG + Intronic
1033164048 7:139023463-139023485 ATGCAAGAGCAGTGGGAGAAGGG - Intergenic
1033956734 7:146858739-146858761 ATGTAATATCAGTTGCTGAAAGG + Intronic
1034092485 7:148376857-148376879 CTGTTAGAGCAGGAGCTGACAGG + Intronic
1035261628 7:157665169-157665191 CTTTAAGTGAAGTGGCTGGAAGG - Intronic
1035627214 8:1080018-1080040 CTGAAAGAGGAGTGGGTTAAGGG + Intergenic
1036102612 8:5803187-5803209 CTGGCAGAGCAATGGATGAAAGG + Intergenic
1039098567 8:33914567-33914589 CTGAAATTGCAGTGGCTGAGTGG - Intergenic
1039660070 8:39451785-39451807 CTGTTAGAGTAGTGACTGGATGG - Intergenic
1042736177 8:71992071-71992093 ATGTAATAGCAGTGGTTGCAGGG - Intronic
1042976938 8:74479840-74479862 CAGCAAGAGCAGAGGCTGTAGGG + Intronic
1047717921 8:127612896-127612918 CTGGCAGAGCTGTGGCTGAGAGG - Intergenic
1048538276 8:135317905-135317927 CTGTGAGAACAGTGGATGGAAGG - Intergenic
1050482131 9:6098126-6098148 CTGTCAGAGCAATGGCAAAAAGG + Intergenic
1051214021 9:14777043-14777065 CTGCAAGAGTAGTGGGTGCAGGG - Intronic
1052218084 9:25990491-25990513 CTGCTACAGCCGTGGCTGAAAGG - Intergenic
1053621555 9:39824672-39824694 CGGTAAGATCAGTGGTTGCAAGG + Intergenic
1053883543 9:42619633-42619655 CAGTAAGATCAGTGGTTGCAAGG - Intergenic
1053889126 9:42674665-42674687 CAGTAAGATCAGTGGTTGCAAGG + Intergenic
1054222562 9:62427097-62427119 CAGTAAGATCAGTGGTTGCAAGG - Intergenic
1054228148 9:62482078-62482100 CAGTAAGATCAGTGGTTGCAAGG + Intergenic
1055804970 9:80082444-80082466 TTCTAAAAGCAGTGGCTGTAAGG - Intergenic
1055834152 9:80419221-80419243 CTGCAACTGCAGTGGCAGAAGGG + Intergenic
1057718538 9:97514673-97514695 CTGTAAGAGCAGTGGATGAAAGG - Intronic
1059830625 9:118091331-118091353 TTGTAAGGGCAGTGAATGAATGG + Intergenic
1060368061 9:123039985-123040007 ATGTAAGAGCAGTGGCTTTTAGG + Intronic
1061046824 9:128169787-128169809 CTGTGAGCCCCGTGGCTGAATGG + Intronic
1061935529 9:133855486-133855508 CTGCAGGAGCAGAGGCTAAAAGG + Intronic
1187685025 X:21807462-21807484 TTGCATGAGCAGTGTCTGAACGG - Intergenic
1188517979 X:31007946-31007968 CTGCAACAGCAGAGGCTAAAGGG + Intergenic
1190678628 X:52804877-52804899 CTGTGAGAGAACTGGCTGACTGG - Intergenic
1190726999 X:53196252-53196274 GTGCAAGAGCTGTGGCAGAAGGG - Intronic
1192365870 X:70472605-70472627 ATGTTTGAGCAGAGGCTGAAGGG + Intronic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1197501228 X:127244400-127244422 CTGTTGGAGCAGTCGCTGACAGG + Intergenic
1198086413 X:133286785-133286807 CTGTAAGGACAGTGGCTTCAGGG + Intergenic
1198312885 X:135437766-135437788 CTGACAGTGGAGTGGCTGAATGG + Intergenic