ID: 1073318152

View in Genome Browser
Species Human (GRCh38)
Location 10:102597323-102597345
Sequence CTGGGGAAAAGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1837
Summary {0: 1, 1: 1, 2: 17, 3: 199, 4: 1619}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073318152_1073318162 1 Left 1073318152 10:102597323-102597345 CCTTCCTCCTTCCTTTTCCCCAG 0: 1
1: 1
2: 17
3: 199
4: 1619
Right 1073318162 10:102597347-102597369 GCCTGGTTTCCAGTCTCTCTAGG 0: 1
1: 0
2: 4
3: 26
4: 307
1073318152_1073318165 6 Left 1073318152 10:102597323-102597345 CCTTCCTCCTTCCTTTTCCCCAG 0: 1
1: 1
2: 17
3: 199
4: 1619
Right 1073318165 10:102597352-102597374 GTTTCCAGTCTCTCTAGGATGGG 0: 1
1: 0
2: 1
3: 10
4: 152
1073318152_1073318164 5 Left 1073318152 10:102597323-102597345 CCTTCCTCCTTCCTTTTCCCCAG 0: 1
1: 1
2: 17
3: 199
4: 1619
Right 1073318164 10:102597351-102597373 GGTTTCCAGTCTCTCTAGGATGG 0: 1
1: 0
2: 2
3: 18
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073318152 Original CRISPR CTGGGGAAAAGGAAGGAGGA AGG (reversed) Intronic
900130177 1:1084087-1084109 CTCGGGAACAGGAAAGAGCATGG + Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
900471915 1:2859278-2859300 CAGGGAGGAAGGAAGGAGGAAGG + Intergenic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
900756667 1:4440174-4440196 CTGGGGTGAAGGAAAGAGGCTGG - Intergenic
901187313 1:7383209-7383231 CCGCAGAAAAGGAAGAAGGAGGG + Intronic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901286835 1:8087107-8087129 ATGGGGAAAAGGCAGGAGGGAGG - Intergenic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901659755 1:10791347-10791369 CTGGGAAAAAGAAGGGAGGTGGG + Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902156048 1:14487419-14487441 CTGGGGATGAGAAAGGAGGTGGG - Intergenic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902781916 1:18710463-18710485 CCAGGGACGAGGAAGGAGGAGGG + Intronic
902892551 1:19454942-19454964 CTTGGTAAAGGGAAGGAAGAGGG + Intronic
903170836 1:21552141-21552163 AAGGAGAAAAGGAAGGAGGGAGG - Intronic
903172020 1:21560289-21560311 CTGGGTAGAAGGAATGAGCATGG + Intronic
903215241 1:21840018-21840040 CTGGGAGAAAGCAAGGAGGCTGG + Intronic
903305987 1:22413721-22413743 CCAGGGAAGAGGAAGGAGGAAGG - Intergenic
903331732 1:22600124-22600146 AAGGAGAGAAGGAAGGAGGAGGG + Intronic
903350516 1:22713728-22713750 GAGGAGACAAGGAAGGAGGAAGG - Intronic
903361681 1:22780975-22780997 CTGGGGCAATGGAAGTAGGCGGG + Intronic
903571143 1:24306380-24306402 ATGGGGAAGAGAAAGAAGGATGG + Intergenic
903755434 1:25657327-25657349 CTGGGGAGAAGGAAGGGCAAGGG + Intronic
903947397 1:26972329-26972351 TTGGGGAATAGGAAGGAGGCTGG + Intergenic
904105548 1:28079064-28079086 CTGGGGAAAAAAAATGAGAATGG - Intronic
904335960 1:29798277-29798299 CTGGGGAAGAGGAGGCAGGGTGG - Intergenic
904446125 1:30574252-30574274 CTGGGCCAAAGGAGGCAGGAAGG - Intergenic
904480702 1:30791581-30791603 AGGGAGAGAAGGAAGGAGGAAGG + Intergenic
904696421 1:32334310-32334332 GTGGGGACAGGGAAGGAGGTAGG + Exonic
904702449 1:32365988-32366010 CTGGAGGAAAGGAAGGAGGTGGG + Intronic
904809274 1:33152867-33152889 ATGGGGAGAAGGCAGGAGCAAGG + Intronic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905017877 1:34789954-34789976 CTGGGGGAAATGAAGTAGGGAGG - Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905259486 1:36707339-36707361 CTGGGGAGAAGGAACGTGCAAGG - Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
905456323 1:38090534-38090556 CAGGGGGAAAGGAAAGGGGATGG + Intergenic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
905882960 1:41476447-41476469 TTATGGAAAAGGCAGGAGGAGGG + Intergenic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
905943888 1:41885710-41885732 GAGGGGGAAGGGAAGGAGGAAGG - Intronic
905975410 1:42170648-42170670 CTAGGGAAAAGGAAAAAGAAAGG + Intergenic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906562586 1:46770136-46770158 CTTGGCAAATGGAAGGAGAAGGG - Intronic
906562652 1:46770507-46770529 CAGGGGAAAAGGGTGGAGGGTGG - Intronic
906581877 1:46941530-46941552 GTGGGGAGAGTGAAGGAGGAGGG + Intergenic
906615062 1:47228368-47228390 TTGGGGAGAATGAAGGAGGAGGG + Intronic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
906726526 1:48048455-48048477 CCTGGGAAAAGGAAGGTGGCTGG + Intergenic
906843562 1:49165684-49165706 ATGGAGGAAAGGAGGGAGGATGG + Intronic
907036822 1:51223390-51223412 GTGGGGAAAAGGGAGGATCAGGG + Intergenic
907170175 1:52455666-52455688 GGGGGGAGAGGGAAGGAGGAAGG + Intronic
907582224 1:55582639-55582661 GAGGGGCAATGGAAGGAGGAAGG + Intergenic
907814340 1:57903503-57903525 TTGGGGAGAAAGAAGGTGGAAGG - Intronic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908115229 1:60934087-60934109 CTGGGACAAAGGAAGGAGAGTGG - Intronic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908466856 1:64404653-64404675 ATGGGGAGAAGGAAGCAAGAGGG - Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908578753 1:65490849-65490871 CTGGGGAAACGCAATCAGGAAGG - Intronic
908812805 1:68001317-68001339 CTGGAATAAAGGAAGGAGTATGG - Intergenic
909070566 1:70988531-70988553 CTGGTCAGTAGGAAGGAGGAAGG - Intronic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909482888 1:76144265-76144287 CTGAGGCCAAGGAAAGAGGATGG + Intronic
909719111 1:78746203-78746225 CTGGTGGAAAGGTAGGAGTATGG - Intergenic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
909882581 1:80898719-80898741 ATGAGAAAAAGGAAAGAGGAGGG - Intergenic
910561984 1:88600626-88600648 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
910868093 1:91806137-91806159 TTAGTGAAAAGGATGGAGGAGGG - Intronic
910870759 1:91830712-91830734 CTGGGGCACAGGAAGAATGAAGG + Intronic
910946655 1:92599990-92600012 CTGGAGAAAAGGAAACTGGATGG + Intronic
911002372 1:93180013-93180035 CTGGGTTAAAGGAAGGAGGCTGG + Intronic
911314488 1:96339586-96339608 CAGAGGAAAAGAGAGGAGGAAGG - Intergenic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
912058626 1:105636332-105636354 CTGAGGGACAGCAAGGAGGAGGG - Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912309285 1:108603338-108603360 CTGGGGACAACCAAAGAGGAGGG + Intronic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912446055 1:109737644-109737666 CCGGGGAAAAGGTAGGAAGAAGG - Exonic
912667395 1:111594519-111594541 AAGGGGAAAGGGAAGAAGGAAGG + Intronic
912696929 1:111848911-111848933 CAGGGGAAAAGGGAAGAGCAAGG - Intronic
912757069 1:112333388-112333410 TTGGGGAGAAGGAAAGTGGAAGG - Intergenic
912956441 1:114156900-114156922 CTGGGGCAAAGGGAGGAGGGAGG + Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913010443 1:114677845-114677867 TTGAGGAAAGGGAAGAAGGAAGG - Intronic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913154138 1:116077810-116077832 ATAGGGAATAGGAAGTAGGAGGG + Intergenic
913243921 1:116854984-116855006 GTGGGGAGAAGGAAGGAGTGTGG - Intergenic
913260466 1:116993063-116993085 CTGGGGAAAGGGTAGGAGTGGGG + Intergenic
914245729 1:145884800-145884822 CTGGGGAAAAGCAGGCAGAAAGG + Intronic
914708110 1:150188101-150188123 GTAGGGAAAAGGAAGAAGGGAGG + Intergenic
914850985 1:151314130-151314152 CTAGAGAAAAGGAAGAGGGAGGG - Intronic
914960101 1:152197497-152197519 AGGGGAAAAAGGAAGGGGGAAGG - Intergenic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915029124 1:152861058-152861080 AGGAGGAGAAGGAAGGAGGAGGG - Intergenic
915098202 1:153478987-153479009 CTGGAGACTAGGGAGGAGGAAGG - Intergenic
915289456 1:154873383-154873405 CTGGTGAGAAGGAAGGCAGAGGG - Intergenic
915479537 1:156175488-156175510 AGTGGGAAGAGGAAGGAGGAAGG - Intronic
915583492 1:156830433-156830455 CTGGGCACAAGGGTGGAGGAGGG - Intronic
915740322 1:158113962-158113984 CTGGGGGTGAGGAAGGAGGCAGG + Intergenic
916012542 1:160719026-160719048 CTGGATAAAAGGAAGTAAGAGGG + Intergenic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916212223 1:162368251-162368273 CTGGGCTACAGGCAGGAGGAAGG - Exonic
916247959 1:162707245-162707267 CTTAGGAAAAAGAAGCAGGATGG - Intronic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916399267 1:164428544-164428566 CTGGGGGATAGGGAGGAGGGAGG + Intergenic
916447012 1:164881645-164881667 GTGGGGAAAAAGAGGAAGGAAGG + Intronic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
917667797 1:177242177-177242199 CAGGGGAAAAGAAAAGAGGCTGG - Intronic
917680273 1:177358824-177358846 AGGGGGAAAAGGAGGAAGGAAGG + Intergenic
917680455 1:177360952-177360974 CTGGGGCACAGGAAGGGTGAAGG - Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918158857 1:181878275-181878297 TGGGGGAAATGGTAGGAGGAGGG + Intergenic
918407191 1:184222919-184222941 CTGGGGACATGGAAAGAGAAAGG - Intergenic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
918876129 1:190046259-190046281 AAGGAGAAAAGGAAGAAGGAAGG + Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919406962 1:197197375-197197397 CTGGTGAAAAGCAAGCAGCAGGG + Intronic
919592635 1:199523605-199523627 CAGGGGAAAGGGTAGGAGGGAGG - Intergenic
919613151 1:199772025-199772047 AAGGGGAAAAGGAAGGGGAAAGG + Intergenic
919846940 1:201648432-201648454 CCGGGAAAAAGGAAAGAGCAGGG - Exonic
919849774 1:201664840-201664862 CAGGGGAAAAGGGAGGAGATGGG - Intronic
919856974 1:201712674-201712696 CTTTGGGAAAGGGAGGAGGAAGG + Intronic
919861505 1:201741789-201741811 GTTGGGTAAAGGAAGGAGGCGGG - Intronic
920058159 1:203207708-203207730 CAGGGGAGAAGAAAGAAGGAGGG + Intergenic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920363000 1:205432184-205432206 GAAGGGAAAAGGAGGGAGGAGGG + Intronic
920569898 1:207008646-207008668 CTGAGGCAAAGGAAGGGGGCTGG + Intronic
920646703 1:207809065-207809087 CTGGGAAGAAGGTAGGAGGTGGG - Intergenic
920739813 1:208569867-208569889 CGGGGGAAAAGGTAGGAAGAGGG - Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
920913329 1:210237395-210237417 CTGCGGAAACGAGAGGAGGAGGG + Intronic
920916593 1:210262574-210262596 ATGAGGAGAAGGAAGGAGGGAGG - Intergenic
921185375 1:212665531-212665553 CAGGGGGCGAGGAAGGAGGAGGG - Intergenic
921225335 1:213014030-213014052 TTGGGGGAAATGAAAGAGGATGG + Intronic
921294363 1:213688231-213688253 TTGGGGAGAAGGAAGTGGGAGGG - Intergenic
921571489 1:216784719-216784741 TGGGGCAAAAGGGAGGAGGAAGG - Intronic
921604204 1:217136677-217136699 CTGGCCAAAAGGAAAGGGGAAGG - Intronic
921747181 1:218752151-218752173 CTTGGGAACAGGTAGGAGGGGGG + Intergenic
921888487 1:220329894-220329916 CTGGGAAGAGGGAAGGAGAAGGG + Intergenic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922109754 1:222545547-222545569 CTGGGAAAAAGGGAGAAGGGAGG + Intronic
922191536 1:223323174-223323196 GTGACAAAAAGGAAGGAGGAAGG + Intronic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922342078 1:224665771-224665793 CTGGGAAAAAGGGAGGGGGGAGG - Intronic
922367271 1:224877801-224877823 CTGGGGGAAAGGTAGGAGGGGGG + Intergenic
922436048 1:225607726-225607748 TTGGGGAAAAGGAGGGTGGTGGG - Intronic
922468317 1:225860019-225860041 CTGGGGTACAGGAAGGAGGAAGG + Intronic
922471594 1:225880427-225880449 CTGAGGAGAAGGCAGGGGGAGGG + Intronic
922567433 1:226610140-226610162 CTGAGGAAATGGCAGGAGGCAGG - Intergenic
922912916 1:229232524-229232546 CTAGGCAACAGGATGGAGGATGG + Intergenic
922930357 1:229384190-229384212 CTAGCCAGAAGGAAGGAGGAAGG - Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923268472 1:232334599-232334621 AGGGGCAAAAGGGAGGAGGAAGG - Intergenic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
924005131 1:239600709-239600731 GAGGGAAGAAGGAAGGAGGAAGG - Intronic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
924710433 1:246526618-246526640 ATGGGGCAAAGGAGGGAGCATGG + Intergenic
1062773400 10:123639-123661 ATGGAGGGAAGGAAGGAGGAAGG + Intergenic
1062839603 10:659858-659880 CTGGGAAAGAGAAAGCAGGAAGG - Intronic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063369695 10:5513067-5513089 CGTGGGGAAAGGAAGGAGGCCGG + Intergenic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063548710 10:7007595-7007617 GTAGGGATAAAGAAGGAGGAAGG - Intergenic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1064007417 10:11709506-11709528 GTGGGGAAGAGAGAGGAGGATGG + Intergenic
1064134867 10:12741852-12741874 TTTGGGACAAGGAGGGAGGATGG + Intronic
1064283751 10:13973744-13973766 AAGGGAAGAAGGAAGGAGGAAGG + Intronic
1064463270 10:15555465-15555487 CTGCGGACAGGGAAGGAGGGAGG + Intronic
1064510480 10:16084437-16084459 CGGGGGAAAAGGAAAAAGAAAGG - Intergenic
1064603998 10:17019372-17019394 ATGGGGAAAAGGAAGGGGTAGGG - Intronic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1064725135 10:18271615-18271637 ACCGGGAGAAGGAAGGAGGAAGG - Intronic
1065229178 10:23579511-23579533 TTGAGCAAAAGGAAAGAGGAGGG + Intergenic
1065242412 10:23720013-23720035 CTGGGGAGAAGGGGGGAGGGTGG + Intronic
1065261280 10:23926113-23926135 CTCAGGAAAAAGAAGGAAGAAGG + Intronic
1065890766 10:30119241-30119263 CAGGGGAAAAGGCAGGAGGGAGG + Intergenic
1065916759 10:30359555-30359577 GTGGGGGAAAGGAAGGATGGTGG - Intronic
1065966204 10:30772644-30772666 CCAGGCAACAGGAAGGAGGAAGG - Intergenic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066224131 10:33365811-33365833 CAGGGGAGAAGGAAGGGGGATGG - Intergenic
1066995575 10:42559981-42560003 TTTGGGAAAAGGAAGAATGAAGG + Intergenic
1067023989 10:42827594-42827616 GTGGGGATAAGGAAGCAAGAGGG - Intronic
1067437280 10:46287129-46287151 CTGGTGAAAGGGCAGGAGGAGGG + Exonic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1067684005 10:48456582-48456604 CTGGGGGAAGGGCAGGAGGCAGG + Intronic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1067844767 10:49710867-49710889 CTGGGGAATGGGGAGAAGGAGGG - Intergenic
1068297006 10:55084122-55084144 CTGGGAAAAAGGAAGGAAACTGG + Intronic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1068948602 10:62755104-62755126 CAGGAGAGAAGGAAGGAGGGAGG + Intergenic
1069060975 10:63894190-63894212 ATGGGAGAAGGGAAGGAGGAAGG - Intergenic
1069939031 10:71940812-71940834 TTGGGGAAGAGGAAGGAGAGAGG + Intergenic
1070025286 10:72626177-72626199 CAGAGGAAAAGGAACGGGGAGGG + Intronic
1070199151 10:74186282-74186304 CTGTGGAAAGGAAAGGAGAAGGG - Intronic
1070489646 10:76964606-76964628 CTGGGCAAAAGAAAGAAGGAAGG - Intronic
1070494825 10:77011915-77011937 TTGGGGAATAGGAATGAGAAAGG + Intronic
1070509468 10:77147426-77147448 CAGGGGGAAGGGAAGGAGGGAGG - Intronic
1070539910 10:77408661-77408683 CTTGGGAAAAGAAAGGAACATGG + Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070735443 10:78860832-78860854 CTGGGGAAAAGGGCAAAGGAAGG - Intergenic
1070782344 10:79145014-79145036 CTGGGCAAGAGGAAGAAAGAAGG - Intronic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071254008 10:83850482-83850504 CAGAGGAAAAGGAAGGAGCGAGG - Intergenic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1071809317 10:89161374-89161396 CTGGGGAATAGGAAGGATAGAGG - Intergenic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072148267 10:92663388-92663410 CTGAGGAACAGAAAGGAAGAAGG - Intergenic
1072222299 10:93336780-93336802 CAGGAGAAAAGGAAGAAGGAAGG + Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072645458 10:97251093-97251115 AAGGGGAAAAGGAAGGGGAAGGG + Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1073034002 10:100550473-100550495 TTGGTGGAAAGGAAGGAGCAAGG - Exonic
1073062696 10:100741949-100741971 CCCGGGAAGTGGAAGGAGGAAGG + Intronic
1073185573 10:101613378-101613400 CTGGGGGAAATGAAGGAAAAGGG + Intronic
1073207923 10:101778489-101778511 CTGGGGCAGAGGAAGAAGGGTGG - Intronic
1073297506 10:102450124-102450146 GTGGGGAGGAGGAAGGAGGGAGG + Exonic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073479983 10:103780283-103780305 CTTGGGGAAGGGAAGGAGAAAGG - Intronic
1073577342 10:104638114-104638136 TTGGGGAAAATGATGGAGGCTGG + Intergenic
1073768162 10:106706470-106706492 CTTGGGAAAGGGATGGAGGCTGG + Intronic
1073796766 10:106996984-106997006 TTAGGGAAAAGGAAAGAGGTAGG + Intronic
1073826714 10:107332222-107332244 CATGGGGAAGGGAAGGAGGAAGG - Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074197562 10:111202926-111202948 TGGAGGAAAAGAAAGGAGGAAGG - Intergenic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074565838 10:114576974-114576996 CTGGGGAAGAAGAAGCAGGTGGG - Intronic
1074827164 10:117222941-117222963 CTGTTGAGAAGGAAGGAGGGAGG - Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075390329 10:122086780-122086802 CTGGAGAAAAGGCAGGAGCTGGG + Exonic
1075478349 10:122756247-122756269 CTTGAGAGAAGGAAGGAGAAGGG + Intergenic
1075575037 10:123571775-123571797 CTGGGGTGAAGGAAGCTGGACGG + Intergenic
1075627363 10:123972602-123972624 ATGGGGAGAAGGGAGGAGCAGGG + Intergenic
1075645218 10:124092470-124092492 GCGGGGAGGAGGAAGGAGGAGGG + Intronic
1075660967 10:124195989-124196011 TTGGGGAAAGGGTAGGAGGTGGG + Intergenic
1075984291 10:126770275-126770297 CTGGGGAAGAGGAAGGAGCCAGG - Intergenic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076171277 10:128322243-128322265 CGTGGGAACAGGAAGGTGGAAGG + Intergenic
1076246988 10:128954971-128954993 CTTGGGAATTGGAAGGAGGGAGG + Intergenic
1076426177 10:130369253-130369275 CTGGGGAAGAGGGAGCAGGAGGG + Intergenic
1076476446 10:130756997-130757019 CTGCAGGAAAGGAAAGAGGAAGG + Intergenic
1076523320 10:131094669-131094691 AGGGAGAGAAGGAAGGAGGAAGG - Intronic
1076697333 10:132253301-132253323 CCGGGCAAAAGGAAGCTGGAGGG + Intronic
1076893265 10:133295578-133295600 GTGGGGAAAAGGCAGGACGCGGG + Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1076989831 11:267288-267310 GTGGGGAGAAGTGAGGAGGAGGG + Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077516215 11:3003566-3003588 CTAGGGAAAAGAAACCAGGAAGG + Intronic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1077841158 11:5976156-5976178 AGGGAGAGAAGGAAGGAGGATGG + Intergenic
1077846466 11:6030478-6030500 GGAAGGAAAAGGAAGGAGGAAGG + Intergenic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078081075 11:8205151-8205173 TTAGGGAAAAAGAAGGTGGAGGG - Intergenic
1078449234 11:11428057-11428079 CTGGGCTAACGGAAGGAAGAGGG - Intronic
1078646012 11:13141951-13141973 CGGGGGAAATGGAAGGAAGCCGG + Intergenic
1078911919 11:15740454-15740476 CAAAAGAAAAGGAAGGAGGAAGG + Intergenic
1079048407 11:17130179-17130201 AGGGAGGAAAGGAAGGAGGAAGG - Intronic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1079104182 11:17559816-17559838 AAGGGAAGAAGGAAGGAGGAAGG + Intronic
1079116600 11:17644063-17644085 CTGGGGGCAAGGGAGGGGGAGGG + Intronic
1079128629 11:17735267-17735289 GCGGGGAGAAGGAACGAGGAGGG + Exonic
1079292642 11:19202043-19202065 CTGGGGGAAGGGCAGGAGGGAGG + Intronic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1079567855 11:21904618-21904640 ATGGAGAAAGGGAAGGAGAATGG + Intergenic
1079977511 11:27110234-27110256 CTGGGAAAAAGGTAGGAGGAGGG - Intronic
1080123471 11:28704044-28704066 CTGGAAAAAAGGAGGAAGGAAGG - Intergenic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1080257672 11:30309456-30309478 CTGAGAAAAAGAAAGAAGGAAGG - Intergenic
1080370734 11:31638541-31638563 CTGACGAAAAGGAGGGAGAAAGG + Intronic
1080539943 11:33256491-33256513 CTAGGGAAAAGGAGGAAAGATGG + Intergenic
1080575706 11:33597371-33597393 GAGGGGAGAAGGGAGGAGGAGGG + Intronic
1081284391 11:41249379-41249401 CTAGGTAAAAGTAAGGAGAATGG - Intronic
1081294674 11:41370891-41370913 CTGAGGAAGAGAAAGGAGAAGGG - Intronic
1081585736 11:44382429-44382451 CTGGGGAAAACGGAGGGGGCAGG + Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081907555 11:46679321-46679343 CTGGGGTGAAGGGAGGGGGAAGG - Intronic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082891040 11:58139043-58139065 CTGGGAAGATGGGAGGAGGAAGG + Intronic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083440027 11:62669997-62670019 CCAGGGAGAAGCAAGGAGGATGG - Exonic
1083464168 11:62834234-62834256 TTGGGGGAAAGGAAGGAGCAGGG - Intronic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1083555491 11:63622939-63622961 CTGGGGAGAAGGAAGGACCAGGG - Intergenic
1083630824 11:64094470-64094492 CTGGGGACAAGGAAGGGTCAGGG + Intronic
1083744665 11:64728789-64728811 CTGGGGCAAAGAACGCAGGATGG - Intronic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1083883796 11:65560913-65560935 GTGGGGAAGAGCCAGGAGGACGG + Intergenic
1083929311 11:65831532-65831554 TTTGAGAAAAGGATGGAGGATGG - Intronic
1084148981 11:67279305-67279327 CTGGAGAAAGGGGAGGAGGTTGG + Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084368879 11:68724626-68724648 CTGGGGAAGAGAAAACAGGAGGG - Intronic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085167148 11:74413041-74413063 CTAGGCAAGAGGAAGGGGGAAGG + Intergenic
1085328643 11:75628272-75628294 CTGGGGGTGAGGAAGGAGTATGG + Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085502660 11:77037978-77038000 AGGGGGAAGAGGGAGGAGGAGGG + Intronic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1085986061 11:81789932-81789954 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
1086089696 11:82993160-82993182 CTGGAGCAAGGAAAGGAGGAAGG - Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086440113 11:86821137-86821159 CTGGGGAAAGTGAAGCATGAAGG - Intronic
1086457154 11:86970466-86970488 CTGGGGAGATGGAAGGATGCTGG - Intergenic
1086472084 11:87124792-87124814 AGGGGAAAAAGGAGGGAGGAAGG - Intronic
1086518765 11:87646102-87646124 AGGGGGAAAGGGAAGGGGGAAGG - Intergenic
1086915382 11:92524069-92524091 CGGGGAAAAAGTAAGAAGGAGGG + Intronic
1087134829 11:94706134-94706156 CTGGGGAAGTGGAAGCAGGGAGG - Intergenic
1087423237 11:97959230-97959252 AAGGAGAAAAGGATGGAGGAAGG + Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087931869 11:103987275-103987297 GGGTGGGAAAGGAAGGAGGATGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088343953 11:108801577-108801599 GTGGTGAAAAGAAAGTAGGAAGG - Intronic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088579269 11:111299759-111299781 CGGGGGCGAAGGAGGGAGGAGGG + Intronic
1088909483 11:114180132-114180154 TGGGGATAAAGGAAGGAGGAAGG - Intronic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089074759 11:115729098-115729120 CAAGGGAAAAGCAAGGAGGTGGG - Intergenic
1089173725 11:116533775-116533797 CTGGGGGAGAGGCAGGAGGCTGG - Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089330239 11:117684273-117684295 GTGGGGAGAAAGAAGGAGAAGGG - Intronic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089432524 11:118436176-118436198 CTCGGGAAAAGGAGGGGGGAAGG - Intergenic
1089474911 11:118751822-118751844 CTGGGGAAAGGGGACAAGGAAGG - Exonic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089926529 11:122264057-122264079 TTGGGTAACAGGGAGGAGGAAGG - Intergenic
1089965888 11:122655079-122655101 AAGGGAAAAAGAAAGGAGGAAGG - Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090260447 11:125315171-125315193 GAGGAGAAAAGGAAGGAGGTGGG - Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090407968 11:126488759-126488781 GTGGGGAACAGGTAGGAGCAGGG - Intronic
1090417854 11:126552965-126552987 CTGGGGAAGAGGATGTGGGAAGG - Intronic
1090501217 11:127263241-127263263 CTGGGCAAAGGGCAGAAGGAGGG + Intergenic
1090623550 11:128584849-128584871 GGGAGGAAAGGGAAGGAGGAGGG + Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090972496 11:131655409-131655431 TTGCCAAAAAGGAAGGAGGAAGG - Intronic
1091051830 11:132379388-132379410 TTGGGGAAAAGGTATGTGGAAGG + Intergenic
1091216806 11:133907232-133907254 CTGGGTGAAAGGAAGGACCAGGG + Intergenic
1091252341 11:134154423-134154445 CTGAGGAAGAGGACGCAGGAGGG - Intronic
1091375509 12:22488-22510 CAGGGGAGAAGGAAGGATGGAGG + Intergenic
1091682992 12:2540197-2540219 CTGGGGAGAGGGAAGGAGAGTGG + Intronic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1091916317 12:4273620-4273642 GAGGGGAAAAGGAGGGAGGGAGG + Intergenic
1092125782 12:6074133-6074155 ATGGGGAAAAGGAGGAGGGATGG - Intronic
1092191534 12:6524880-6524902 CTGGGGAAAAGAAAAGAGCCTGG + Intronic
1092236592 12:6814499-6814521 CTTGGGAAAAGGAAAGAAAAGGG + Intronic
1092279449 12:7088780-7088802 ATGGGGAAAAGGGGGGAAGAAGG - Intronic
1092406177 12:8223581-8223603 CTGGGGAAAACCAGGGAGGACGG - Intronic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092482105 12:8869016-8869038 CTGTGGAAAAGGTAGGAAAAGGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092846426 12:12589454-12589476 CTGGGTAGAAGGAAGGACAAAGG + Intergenic
1092938541 12:13386314-13386336 CTGGGGAGAAGGAACAAGGAAGG - Intronic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093235958 12:16608612-16608634 TTGGGGAAAAAGGAAGAGGATGG - Intronic
1093339221 12:17950431-17950453 CTTGGTACAAGGAAGGAAGAAGG - Intergenic
1093432414 12:19098937-19098959 GTGGGGCTAAGGCAGGAGGATGG - Intergenic
1093734592 12:22606239-22606261 AAGGAGAGAAGGAAGGAGGAAGG - Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1093940799 12:25051815-25051837 ATGGGGTAAAGGTAGGGGGAGGG - Intronic
1094441924 12:30487064-30487086 CTGGGGATAAGGGAGGAGCAGGG + Intergenic
1095140108 12:38651429-38651451 TTGCGGAAAAGGAATGAGGCAGG + Intronic
1095251848 12:39988644-39988666 AGGGAGAAAAGGAAGGAGGGAGG + Intronic
1095369533 12:41450504-41450526 CTGGGGAATCTGAAGAAGGAGGG + Intronic
1095380959 12:41591413-41591435 CTGAGTAAAAGGGAGTAGGAAGG + Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1095972945 12:47916818-47916840 CTGTGGAAAGGGAAAGAGCATGG + Intronic
1096262817 12:50103671-50103693 CTGGGGGACAGAAAGGAGCAAGG + Intergenic
1096276378 12:50211731-50211753 CTGAGGTACAGGAAGAAGGAGGG + Intronic
1096395664 12:51264390-51264412 CAGGGGCAGAGGAAGGAGCATGG + Intronic
1096469889 12:51869327-51869349 TGGGGGAAGAGGAGGGAGGAGGG + Intergenic
1096670530 12:53195843-53195865 CTATGGAATAGGAAGGAGGTAGG + Intronic
1096694204 12:53338519-53338541 AAGGGGAAAAGGAGGAAGGATGG + Intronic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1096789480 12:54035910-54035932 CTGGGGAAGAGGGAGCAGGGAGG + Intronic
1096846065 12:54407792-54407814 CTGGGGCCAAGGGAGGGGGATGG - Intronic
1096978022 12:55710854-55710876 CAGGGGACAAGGATGGAGGGGGG + Intronic
1097326710 12:58285394-58285416 CTGGGAATAAGAATGGAGGAAGG + Intergenic
1097432467 12:59527074-59527096 CTGGGGCAAAGTAAGCAAGAGGG + Intergenic
1098082209 12:66799545-66799567 GAGGGGAAAAGGAAGGAGAGAGG - Intronic
1098101413 12:67021288-67021310 TTGGGGGACAGGAAGAAGGAGGG - Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099366019 12:81766016-81766038 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1099535412 12:83837599-83837621 CTGGGGTAAGGAAATGAGGAAGG - Intergenic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1099650122 12:85415906-85415928 CTGAGGAAAATCAAGGTGGAAGG + Intergenic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1100372472 12:93980865-93980887 AGGGGAAAAAGGGAGGAGGAAGG + Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100538867 12:95538815-95538837 TTGGAGGAAAGAAAGGAGGATGG + Intronic
1100593384 12:96050543-96050565 AAGGGGAAAGGGAAGGAGGGAGG + Intergenic
1100759817 12:97794907-97794929 CTGGGCAAAAGGCAGGGAGAGGG - Intergenic
1100877270 12:98975304-98975326 AGGAGGAAAAGGAAGAAGGAAGG - Intronic
1101064527 12:101005885-101005907 TAGGGGAAAAGAAAGGAGAAAGG - Intronic
1101345038 12:103878953-103878975 CAGGGGAGAAGGAAGCAGCAAGG - Intergenic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1101744949 12:107532337-107532359 CTGGGGACAAGGATGCTGGATGG - Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102230251 12:111257257-111257279 AAGAGGAAAAGGGAGGAGGAGGG - Intronic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102839530 12:116103355-116103377 GTGGGGCCAAGGCAGGAGGATGG - Intronic
1103035644 12:117654340-117654362 CTGGGGAAGAGAAGGCAGGATGG - Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103164308 12:118757109-118757131 AAGGGGAGAAGGAAGGAGGGAGG + Intergenic
1103176563 12:118868942-118868964 CCAGGGAAAAGGAAGGAGGGAGG - Intergenic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103200159 12:119081654-119081676 CTGGGGAACAGGATGCAGGAAGG + Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103361920 12:120359613-120359635 CTGGGGGAAGGGAAGGAGACTGG + Intronic
1103397471 12:120619143-120619165 GAGGGGCTAAGGAAGGAGGAGGG - Intergenic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103597788 12:122034784-122034806 CCGGGAGAAAGGAGGGAGGATGG - Intronic
1103705671 12:122870501-122870523 GTGAGGCAAAGGCAGGAGGATGG + Intronic
1103903280 12:124314568-124314590 CTGGGGAGAAGCCGGGAGGATGG + Exonic
1104645281 12:130493030-130493052 CTGGGGCTCAGGCAGGAGGATGG + Intronic
1104737365 12:131144327-131144349 ATGGGGAAAAGGAGGTATGAGGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104842604 12:131832053-131832075 CGGGGGGAAGGGAAGGGGGAAGG + Intronic
1105351930 13:19623692-19623714 GTGGGGAAAAGGAGGCAGGTGGG - Intergenic
1106030842 13:26001022-26001044 GTGGGGGAAAGGAAGTGGGAAGG - Intronic
1106288854 13:28342244-28342266 CTGGGGAGTAGGAAGGACTAGGG + Intronic
1106436709 13:29729696-29729718 CTGGAGTAAATGCAGGAGGAGGG - Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1106770593 13:32957617-32957639 GTGGGGAAAGGGAAGGAAGCAGG + Intergenic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107333087 13:39322696-39322718 AGGGAGAGAAGGAAGGAGGAAGG + Intergenic
1108088428 13:46819602-46819624 CTGGAGTGAAGGAAGGAGTATGG + Intergenic
1108283353 13:48881448-48881470 CTGGAGAAGAGAAAGGAGAATGG + Intergenic
1108346616 13:49552689-49552711 CTGCAGAACAGCAAGGAGGAAGG + Intronic
1108876083 13:55052802-55052824 GTGGGGAAAAGGAAGCTTGAAGG - Intergenic
1109140029 13:58703668-58703690 CTTGGGCAAGGGAAAGAGGAAGG + Intergenic
1109147692 13:58801808-58801830 GAAGGGAAAAGGAAGGAAGAAGG + Intergenic
1109239557 13:59868718-59868740 CTGAGGAGAGGGAAGAAGGAAGG - Intronic
1109519114 13:63485433-63485455 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1109642850 13:65213024-65213046 CAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110418828 13:75281434-75281456 CTTGGGAAAGGGTAGGAGGAGGG - Intergenic
1110788364 13:79560198-79560220 GAAGGGAAAAGGAAGGGGGAAGG - Intergenic
1111232216 13:85358460-85358482 GAGGGTAAAAGGTAGGAGGAGGG + Intergenic
1111295902 13:86277524-86277546 CTGGGGAAATGGGACAAGGAAGG + Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111904253 13:94237299-94237321 ATGGAGAAAAGAAAGAAGGAAGG - Intronic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112015186 13:95325604-95325626 GAAGGGAGAAGGAAGGAGGAAGG + Intergenic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112177965 13:97047294-97047316 ATGAGGAGAAGGAATGAGGAGGG - Intergenic
1112423910 13:99279083-99279105 GGTGGGAAAAGGAAGGAGAAAGG - Intronic
1112433310 13:99372381-99372403 GGGGGGAAAATGAAGGATGATGG + Intronic
1112664258 13:101551491-101551513 CTGGAGAAAAGGGAGCAAGATGG + Intronic
1113149987 13:107252481-107252503 GAGAGGAGAAGGAAGGAGGAGGG + Intronic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113303874 13:109054961-109054983 AGGAGGAAAAGGAGGGAGGAAGG - Intronic
1113357169 13:109591850-109591872 CTGGGGATAAGGAAGGTGTAGGG + Intergenic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1113536886 13:111075206-111075228 GTGAGGACAAGGCAGGAGGATGG - Intergenic
1113767936 13:112892672-112892694 CTGGGCTCAGGGAAGGAGGAGGG - Intergenic
1113814054 13:113159418-113159440 CGAGAGAAAAGGAGGGAGGATGG + Intronic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114299723 14:21364358-21364380 GTGGGGGAAGGGAAGGGGGATGG + Intronic
1114423230 14:22602049-22602071 TGGGGGAGAAGGAAGGAGGAAGG - Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114953059 14:27781371-27781393 CTGGGAAAAAGGAAGTAAGGTGG - Intergenic
1115087310 14:29533004-29533026 CTGGAGACAAGGAAGGATAACGG - Intergenic
1115378709 14:32708813-32708835 CTGAGGAAAGCTAAGGAGGAAGG - Intronic
1115730374 14:36262266-36262288 CAAGGCAACAGGAAGGAGGAGGG + Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1115968479 14:38918325-38918347 CAGAGGAAAAGGAGGAAGGAAGG + Intergenic
1116116053 14:40652418-40652440 AAAGGAAAAAGGAAGGAGGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116947434 14:50848850-50848872 GTGGGGAAAAGGCAGGAGTGGGG - Intergenic
1117558622 14:56912077-56912099 GTTAGGAACAGGAAGGAGGAAGG - Intergenic
1117764331 14:59064796-59064818 AAGGGGGAAAGGAAGGAAGAAGG + Intergenic
1117796449 14:59399032-59399054 CTGAAGAAAAGGGAGGAAGAGGG - Intergenic
1117871457 14:60205209-60205231 CTGGGGATCAGGAAGGGAGAGGG + Intergenic
1117974516 14:61283899-61283921 GTGTGGAAAGGGAAGGAGAAAGG + Intronic
1118126279 14:62908361-62908383 CGGGTGAACAGGAAGCAGGAAGG - Intronic
1118171785 14:63395737-63395759 AGAGGGAAAAGGGAGGAGGAGGG + Intronic
1118317895 14:64736927-64736949 CGGGGGAGGAGGAGGGAGGAGGG + Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118680034 14:68231431-68231453 TAGGGGAAAAGGAAAAAGGAGGG - Intronic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1118988986 14:70781032-70781054 CTGGGGAAAAGCACAGAGGATGG - Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1120199398 14:81519794-81519816 TTTGGGCAAAGGAATGAGGAAGG + Intronic
1120421918 14:84298317-84298339 CAGAGGAAAAGGTAGGAGGGAGG + Intergenic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120749861 14:88187309-88187331 GAGAGGAAAAGAAAGGAGGAAGG - Intronic
1120994393 14:90405645-90405667 ATGGGGACAAGGCAGGTGGAGGG + Exonic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121039248 14:90731478-90731500 TTGGGGAAAAGAAAGGTAGAAGG + Intronic
1121064263 14:90946539-90946561 GAAGGGAAAAGGAAGGATGAAGG - Intronic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121548090 14:94777441-94777463 TTGGGCAAAACAAAGGAGGAAGG - Intergenic
1121592320 14:95125573-95125595 GTGGGGGAAGGGGAGGAGGAGGG + Intronic
1121599954 14:95195954-95195976 CTTGGGAGAAGGAGGGAGCAGGG - Intronic
1121695235 14:95907126-95907148 GTGGCAAAAAGGAAGGAGGAAGG - Intergenic
1121798918 14:96757215-96757237 AGGGGGAAGAGGATGGAGGAGGG + Intergenic
1121878166 14:97473838-97473860 GTGGGGAAGAGTCAGGAGGAGGG + Intergenic
1121902447 14:97706332-97706354 CTGGGAAAAAGCAGGGAGGCTGG + Intergenic
1122234748 14:100325293-100325315 CTGGGCAAAGGCCAGGAGGAGGG - Intronic
1122253907 14:100462965-100462987 AAGGGAAAAAGGAAGGAGCAAGG - Intronic
1122253923 14:100463020-100463042 AAGGGAAAAAGGAAGGAGCAAGG - Intronic
1122793093 14:104192667-104192689 CAGGGGAAAAGGAAGGGGCTGGG + Intergenic
1123194896 14:106606687-106606709 CAGGTGAAAAGGGAGGAGGGAGG + Intergenic
1123542316 15:21306563-21306585 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1124190147 15:27567647-27567669 CCGGGGAAAGGGCGGGAGGAGGG - Intergenic
1124343415 15:28904584-28904606 AGAGGGAAAAGGAAGGAAGAGGG - Intronic
1124635463 15:31361920-31361942 CAAGAGAAAAGGAAGGAGGGAGG - Intronic
1124658050 15:31524554-31524576 TTGGGGGAACGGAAGGAGGGAGG - Intronic
1124849700 15:33324321-33324343 CTGGGGAAATGGGGGAAGGAAGG + Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125535814 15:40440904-40440926 CTGGGGACGAGGAAGCAGGAAGG + Intronic
1125736303 15:41928869-41928891 CTGGGGAAAAGGGGGCAGGGAGG - Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1125898711 15:43325696-43325718 GGGGGGAAAAGAAGGGAGGAGGG - Exonic
1126283641 15:46986543-46986565 CTGGGGAAGAGAAGGCAGGATGG - Intergenic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126636622 15:50786295-50786317 CTGGGGAATAGGAAGCAACATGG - Intergenic
1127191546 15:56536608-56536630 CTGGAGTAAAGGCATGAGGAAGG + Intergenic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128484258 15:68069340-68069362 ACGGGCAAAAGGAAGGAGGAGGG - Intronic
1128613838 15:69094264-69094286 GAGGGAAAAAGGAAGGAAGAAGG + Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129025235 15:72565786-72565808 ATGGGGAATGGGAAGGAGCAGGG - Intronic
1129039098 15:72670476-72670498 ATGGGGCAGAGGAAGGAGGCGGG + Intergenic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1129113014 15:73349129-73349151 CTGGAGACCAGGAAGGAGGTGGG - Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1129332131 15:74833148-74833170 AAGGGGAAAAGGAGGGAGGGAGG - Intergenic
1129399610 15:75274326-75274348 ATGGGGCAGAGGAAGGAGGCGGG + Intronic
1129514147 15:76146683-76146705 CTGGGGACAAAGAAAAAGGAGGG + Intronic
1129553470 15:76479161-76479183 ATGAGGAAAAAAAAGGAGGAGGG + Intronic
1129589916 15:76905630-76905652 GTGGTGATAAGGCAGGAGGAGGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129889067 15:79059130-79059152 GAAGGGAAAAGAAAGGAGGAAGG - Intronic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1129958039 15:79657064-79657086 CCAGAGAAAAGGTAGGAGGAAGG - Intergenic
1130060202 15:80564173-80564195 CTGGGGAAAATGATGGATGCTGG - Intronic
1130096126 15:80857464-80857486 CCAGGGGAAAGGAAGGAGAATGG + Intronic
1130107802 15:80942178-80942200 CTGGGGATACGGGAAGAGGAGGG + Intronic
1130133800 15:81164896-81164918 CTGGGGCACAGGATGGAGGGTGG + Intronic
1130514590 15:84616498-84616520 CTGGGTAAAAGCAATGAGGAAGG - Intronic
1130710740 15:86278624-86278646 CTGGGGGAAAGGGAAGGGGAAGG - Intronic
1130803070 15:87287112-87287134 GAGGGGAAAAGAAAGAAGGAAGG + Intergenic
1130987539 15:88854605-88854627 CAGGGAGAAAGGAAGGAGGGAGG - Intronic
1131371698 15:91887264-91887286 CTGGGGAAAATGGCCGAGGAAGG - Intronic
1131499909 15:92952321-92952343 CTGGGGAGGAGGGAGGGGGATGG + Intronic
1131747874 15:95469221-95469243 GTGGGGATGAGGAAGGAGCACGG + Intergenic
1131755891 15:95561584-95561606 CTGGGGAAAAGGTTGAAGTAGGG - Intergenic
1132022295 15:98373138-98373160 CAGGGATAAAGGAAGGAGGGTGG + Intergenic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1202950633 15_KI270727v1_random:33704-33726 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1132570696 16:642691-642713 CTGGGGTGAAGGGCGGAGGAGGG - Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132794821 16:1714640-1714662 CTGGGGAGAAGGAAAGGTGATGG - Intronic
1132804155 16:1768046-1768068 CTGGGGACATGGGAGGAGCATGG - Intronic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1133070582 16:3244124-3244146 CTGGAGCAAAGGTAGGAGAAAGG - Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1133392851 16:5423083-5423105 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1133444870 16:5851412-5851434 CAGAGGAAAATTAAGGAGGAGGG - Intergenic
1133520157 16:6549194-6549216 GAGGGGAAAAGGGAGGAGGAGGG + Intronic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133837790 16:9381916-9381938 CTGGGTATAAGGAAAAAGGAGGG - Intergenic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1133997872 16:10761945-10761967 GAGGGGCAATGGAAGGAGGAGGG + Intronic
1134210847 16:12275294-12275316 CTGGGGAGAGGGAAGAAGAATGG + Intronic
1134301306 16:12993900-12993922 CTGGGGGACAGGAAAGAGGGAGG + Intronic
1134311172 16:13076471-13076493 GTGGGGGAAAGGAGGGAGCAGGG - Intronic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134404806 16:13947146-13947168 ATGGGGAAAGGGAAGGAGCTGGG - Intronic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1134824598 16:17274461-17274483 CAGGGGAAAAGGATATAGGAAGG + Intronic
1134829980 16:17315096-17315118 CTGGGGAAAAGGCAGAAGGAGGG + Intronic
1135010870 16:18877442-18877464 GTGGGGAGAGGGAACGAGGAAGG + Intronic
1135044040 16:19140151-19140173 CTGGGGAGAAGAAAGAAGAAAGG - Intronic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1135317757 16:21465027-21465049 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135346808 16:21695737-21695759 TTGGGGAAAATGAAGGAAGTGGG - Intronic
1135370652 16:21896826-21896848 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135433593 16:22408791-22408813 CTGGAGCAAAGTAAGCAGGAGGG + Intronic
1135441134 16:22473893-22473915 GTGGGGAGAGGGAACGAGGAAGG - Intergenic
1135770445 16:25214337-25214359 AAGGGAGAAAGGAAGGAGGAAGG - Intergenic
1135861415 16:26059255-26059277 TGGAGGGAAAGGAAGGAGGAAGG - Intronic
1136062819 16:27738261-27738283 CTGGAGCCAGGGAAGGAGGAAGG + Intronic
1136289837 16:29264884-29264906 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1136327970 16:29546477-29546499 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1136869910 16:33797351-33797373 CTGGGGAAATGGTAGAAGAAGGG + Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137238563 16:46635324-46635346 GTTGGGAACAGGAAGGAGGAAGG + Intergenic
1137366821 16:47866783-47866805 CTAGGGAGAAGAAAGGAGGCAGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137511996 16:49108899-49108921 GTGGGGAGGAGGAAGGATGATGG - Intergenic
1137688482 16:50403164-50403186 ATGGTGAGAAGGAGGGAGGAAGG + Intergenic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1138097905 16:54227035-54227057 TGGGGGAAAAGGAAGAAAGAAGG + Intergenic
1138276080 16:55736048-55736070 CTGGGGAACAGGAAGGGGAGAGG + Intergenic
1138432487 16:56977964-56977986 CTGGGGAAAAGGAAGTAGCTCGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138482658 16:57314068-57314090 CTGAGGAAAGGGAATGAGAAGGG + Intergenic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1138574270 16:57897544-57897566 CTGGGGCAGAGAAGGGAGGAAGG + Intronic
1138639763 16:58375508-58375530 CTGGGGCCAAAGAAGGAGGGAGG - Intronic
1138988477 16:62361426-62361448 CTGGGCAGAAGAAAGAAGGATGG + Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139433632 16:66924303-66924325 ATGGGGAAAGGAAAGGAGAAGGG - Intronic
1139629180 16:68217768-68217790 ATGGGAAAAAGGGAGGAAGAAGG + Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1139933785 16:70552109-70552131 ATGGGGCAAAGAAGGGAGGAGGG - Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140509052 16:75494456-75494478 CTGTGAAAAAGGGAGGAGAAAGG + Intronic
1140869929 16:79096898-79096920 CTGGGGAGAAGAAAGGATCAGGG + Intronic
1141080565 16:81047992-81048014 TGGGGGAAAAGGAAGGCAGAAGG + Intergenic
1141172583 16:81700688-81700710 CTGGGGAAGAGGCAGCGGGAAGG + Intronic
1141225982 16:82115250-82115272 CAGGGGAAAAGGTGGGAGGGAGG - Intergenic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141617267 16:85217102-85217124 ATGGGGAAACGGAAGCAGAAAGG - Intergenic
1141877947 16:86839025-86839047 CCGGGCAGGAGGAAGGAGGAAGG + Intergenic
1142053975 16:87980384-87980406 TTAGAGAAAAGGAAGGAGGTTGG + Intronic
1142071235 16:88092194-88092216 CCGGGGAAGAGGAAGGAGCTGGG - Intronic
1142095721 16:88238360-88238382 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1203102262 16_KI270728v1_random:1318704-1318726 CTGGGGAAATGGTAGAAGAAGGG - Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142875996 17:2852701-2852723 CTAGGGAAAAGGAAGTGGGCAGG - Intronic
1142962379 17:3558855-3558877 CTGGGGAGGAGGCAGGAGGCAGG + Intergenic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143294838 17:5863208-5863230 AAAGGAAAAAGGAAGGAGGAAGG - Intronic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144196754 17:12902010-12902032 GAAGGGAAGAGGAAGGAGGAGGG - Intronic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144333196 17:14243205-14243227 GAGGGGAGAAGAAAGGAGGAGGG + Intergenic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144575974 17:16429727-16429749 CTGGGGAGATGGCAGGAGGGTGG + Intronic
1144843875 17:18205777-18205799 CTGGGGAGAAGTAAGCAGGAGGG - Intronic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146282728 17:31555635-31555657 CAGGGGAAAGGCAAGCAGGAAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146370710 17:32264359-32264381 CAGGGGAACTGGAAGGAGAAGGG - Intergenic
1146379056 17:32315008-32315030 ATGGGGAGAAGGGAGGAGGTGGG + Intronic
1146529554 17:33596680-33596702 TGAAGGAAAAGGAAGGAGGAGGG - Intronic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1146596476 17:34173404-34173426 GTGGGGAAATGCAAGGAGGAGGG + Intronic
1146642781 17:34553721-34553743 CCGGGGTGAAGGAAGGATGAGGG + Intergenic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1146786242 17:35724460-35724482 CAGGGGAAAGGAAAGGAGTAAGG - Intronic
1146790091 17:35746104-35746126 CTGGGCCAAAGGAACGAGGCAGG + Exonic
1146795237 17:35775747-35775769 GGGTGGAAAAGGAAGGAAGAGGG - Intronic
1146910668 17:36646485-36646507 CTGGGGAAGAGGGTGGAAGAGGG + Intergenic
1146955816 17:36935935-36935957 TTGGGAAGAGGGAAGGAGGAGGG - Intergenic
1146967772 17:37047498-37047520 CTGGGGAACAGGGAGGAGAGGGG - Intronic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147336155 17:39727900-39727922 CTGGGCTGAAGGCAGGAGGAGGG - Exonic
1147667966 17:42160545-42160567 CTGGGAAAAAGGCAGGATGAGGG + Intronic
1147668142 17:42161622-42161644 CTGGGGTAAGGGAAAGAGGTAGG + Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148247127 17:46039954-46039976 CTGGGCAAATTAAAGGAGGATGG - Intronic
1148324951 17:46777893-46777915 CTGGGCAACAGGAAGGAGACAGG - Intronic
1148384259 17:47222900-47222922 CTGGAGAAAGGGGAGCAGGAGGG + Intronic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148482617 17:47970079-47970101 CTGGGGACAAGGAGGCTGGAAGG - Intronic
1148507550 17:48139913-48139935 CTCTCGGAAAGGAAGGAGGAGGG - Intronic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148770625 17:50064054-50064076 CTGGGGATAGGGACGGAGGTGGG - Intronic
1148773588 17:50080599-50080621 CTGGGGAAAGGCATGGAGGTGGG - Intronic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1149009179 17:51836987-51837009 CTGGGGAGAAAGAAGGATGTGGG + Intronic
1149015888 17:51907800-51907822 GCGGGGAAAAGGAAGAAAGAAGG - Intronic
1149071142 17:52544763-52544785 GTGTGTGAAAGGAAGGAGGATGG - Intergenic
1149267308 17:54941013-54941035 CTAGGGAAAAGGAGAGAGGGAGG - Intronic
1149291331 17:55220487-55220509 CAGTGGAAAAGTAAAGAGGAAGG - Intergenic
1149387521 17:56156629-56156651 AGGTGGAAAAGGAAGGAGTAAGG + Intronic
1149634489 17:58155837-58155859 CTCGGGAAAGGCAAGGAGGAAGG + Exonic
1149655455 17:58307538-58307560 GTGGAGGAAAGGAGGGAGGAGGG + Intronic
1149888390 17:60363855-60363877 TTTGGGAGAAGGAAGGAGGAAGG + Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150303432 17:64064757-64064779 GTAGGGAAAAGGAAGAAGAAAGG + Intronic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150633596 17:66897606-66897628 TTGCAGAGAAGGAAGGAGGAAGG - Intergenic
1150841667 17:68613302-68613324 ATAGGGAAGAGGAAGAAGGAAGG - Intergenic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1150922245 17:69495952-69495974 CCAGGGAAAAGGCAGGAGGCAGG - Intronic
1151007501 17:70454989-70455011 ATGGAGGAAAGGAAGGAGGGAGG + Intergenic
1151163331 17:72184041-72184063 CCTGAGAAAAGGCAGGAGGAGGG + Intergenic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151366898 17:73623457-73623479 CTGGGGGGAAGGAAGGAGTGAGG + Intronic
1151454557 17:74218213-74218235 CAAGGGAGGAGGAAGGAGGAGGG - Intronic
1151539596 17:74758294-74758316 CTGGGGGAAAGGACAGATGAAGG + Intronic
1151554598 17:74840388-74840410 CTGGGGGACAGGTAGCAGGAAGG - Intergenic
1151711307 17:75808586-75808608 CTGGGATGCAGGAAGGAGGAAGG - Intronic
1151938078 17:77275826-77275848 CTGGTGCGAGGGAAGGAGGAAGG - Intergenic
1152100809 17:78300883-78300905 TGGGGGAACAGGAAGGTGGAGGG - Intergenic
1152126412 17:78450017-78450039 CAGGGGAAGAGCAGGGAGGAGGG + Intronic
1152257989 17:79251491-79251513 CTGGAGACAAGGGAGGGGGAAGG - Intronic
1152302025 17:79500621-79500643 ATGGGGAAATTGAAGGGGGAAGG - Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152370349 17:79884072-79884094 ATGGCGAAAGGCAAGGAGGAAGG - Intergenic
1152420208 17:80188696-80188718 CTGGGGAACAGCAGGAAGGAAGG - Intronic
1152499767 17:80700063-80700085 ATGGAGAAAAGGTAGGAAGAAGG + Intronic
1153089802 18:1330790-1330812 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1153362593 18:4214220-4214242 CTGAGGAACAGGAAGGTGGCAGG + Intronic
1153851741 18:9101836-9101858 ATGGGCAAAAGGAAGGGGGTGGG + Intergenic
1154051732 18:10966766-10966788 CGGGGGAAAGGGCAGGAGGTGGG - Intronic
1154266432 18:12883375-12883397 CGGGGGAAAATGAAGACGGAGGG + Intronic
1155112476 18:22729673-22729695 CTAGGCAGAAAGAAGGAGGAAGG - Intergenic
1155385751 18:25275642-25275664 ATGGGGAGAAGGAAAGAGGGAGG - Intronic
1155658325 18:28217887-28217909 CTGAAAAAAAGGTAGGAGGAAGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156048133 18:32900237-32900259 ATGGAGACAAGGAAGTAGGAGGG + Intergenic
1156245655 18:35295377-35295399 CTGGGGGAAAAGTATGAGGATGG - Intergenic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156510305 18:37630925-37630947 CTGGGGAAAAGGGGGGATGAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156876466 18:42019913-42019935 CTGGTGGAGAGGAAGTAGGAAGG - Intronic
1157051627 18:44172763-44172785 CTGGGGAAATGGAACAAGGAAGG + Intergenic
1157210940 18:45741331-45741353 CTTGGGAACAAAAAGGAGGAGGG + Intronic
1157327352 18:46678687-46678709 CAGGGAGAAAGGAAGGAGGGAGG + Intronic
1157464825 18:47934034-47934056 CTGGGGAAAAGGGAGCAAGGTGG - Intergenic
1157465184 18:47937909-47937931 CTGGGGAAAAGGGAGCAAGATGG - Intergenic
1157575812 18:48742291-48742313 TAGGGGAAAAGAAAGGAGCAGGG + Intronic
1157589319 18:48826900-48826922 GTGGGGAAATGGAATGGGGAAGG + Intronic
1157595338 18:48860658-48860680 CTGGGGAAAAGGATGGGAGTGGG + Exonic
1157618764 18:49003325-49003347 GAGGGGAAAAGGGAGGAGGATGG - Intergenic
1157702387 18:49770395-49770417 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1158185402 18:54765709-54765731 ATGGGGAAAGGAAAGGAAGAAGG - Intronic
1158434853 18:57428421-57428443 GGGAGCAAAAGGAAGGAGGAGGG + Intergenic
1158900311 18:61956266-61956288 ATGGGGCAATGGAAGGAGGTAGG - Intergenic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159242944 18:65766696-65766718 ATGGGGAGAAGGAAGGGGGGAGG + Intronic
1159267262 18:66098427-66098449 TTCTGGAAAAGGAAGTAGGAAGG - Intergenic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1159478248 18:68952480-68952502 CTGGGATAAAGGAACCAGGAAGG + Intronic
1159826896 18:73224009-73224031 CTGGGGGACAGGAAGAGGGAGGG + Intronic
1159908950 18:74125332-74125354 CTAAGGAAAAGGGATGAGGATGG + Intronic
1160289046 18:77573236-77573258 CTGGGGAAAAGAAAGTAAGAAGG - Intergenic
1160448655 18:78947051-78947073 AGGAGGAAAAGGGAGGAGGATGG + Intergenic
1160479593 18:79226632-79226654 ATGGGGCAAAGGAAGGGGGAAGG - Intronic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1161012613 19:1967850-1967872 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161012634 19:1967911-1967933 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161012694 19:1968080-1968102 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012730 19:1968188-1968210 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012789 19:1968358-1968380 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161370553 19:3908696-3908718 GAGGAGAAAAGGGAGGAGGAGGG - Intronic
1161426338 19:4205520-4205542 CTGGGCAAATGGCAGTAGGAGGG + Intronic
1161496902 19:4591445-4591467 CTGGAGGCCAGGAAGGAGGAGGG + Intergenic
1161735586 19:5990476-5990498 CTGGGGAGTAGCAAAGAGGAAGG + Intergenic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1161934564 19:7363728-7363750 ATGGGTGAAAGGAAGGAAGATGG + Intronic
1161934619 19:7364016-7364038 GTGGATGAAAGGAAGGAGGATGG + Intronic
1161957982 19:7506802-7506824 CTGGGGAAGAGGGAGGAGGTGGG - Intronic
1162153459 19:8661127-8661149 AAGGGAAAAAGGAAGAAGGAAGG - Intergenic
1162389377 19:10380226-10380248 GTGGGGACGAGAAAGGAGGAAGG - Intronic
1162876782 19:13626590-13626612 AAGGGGAAAGGGAAGGGGGAAGG + Intergenic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163092675 19:15031806-15031828 GCAGGGAGAAGGAAGGAGGAAGG + Intergenic
1163177305 19:15573444-15573466 CAAGGGCAAAGGAAGGAGGGAGG - Intergenic
1163442691 19:17329633-17329655 CAGGAGAGAAGGATGGAGGAGGG + Intronic
1163488417 19:17603088-17603110 CTGGGGGAAAGAAAAGAGGGTGG + Exonic
1163571612 19:18085368-18085390 CCAGGGAAAGGGAAGGAGGATGG - Intronic
1163879053 19:19901636-19901658 ATGGGGAAAAAGAAGGGGTAGGG - Intronic
1164592609 19:29514496-29514518 CAGGGGATGAGGAAGAAGGAGGG + Intergenic
1164609829 19:29624377-29624399 CAGGGGAAAAGGGAGCAGGCAGG + Intergenic
1164680427 19:30130827-30130849 AAAGGGAGAAGGAAGGAGGAGGG - Intergenic
1164731051 19:30504577-30504599 TTGGAGAGAGGGAAGGAGGAAGG - Intronic
1164855453 19:31517372-31517394 GTGGGAAGAAGGAAGAAGGAGGG + Intergenic
1165077274 19:33286844-33286866 CAGGGGTAAGGGAATGAGGATGG + Intergenic
1165116718 19:33533258-33533280 CTGGAAACCAGGAAGGAGGAGGG - Intergenic
1165355902 19:35303889-35303911 CAGGGGAAATGGAAACAGGAAGG - Intronic
1165361669 19:35340802-35340824 CGGGAGAAGAGGAAGCAGGAGGG + Intronic
1165374488 19:35432141-35432163 CTGGGGAAAGGAGAGGAGGTGGG + Intergenic
1165408077 19:35642754-35642776 CTAGGGCAAAGGGAGGAGGGGGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165705768 19:37975275-37975297 CCGGGGACCAGGAAGGAGGATGG + Intronic
1165776922 19:38410089-38410111 CAGGGGACCTGGAAGGAGGAAGG + Exonic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1165938603 19:39403840-39403862 CGGGGAAAAAGGGGGGAGGAGGG - Intergenic
1165951391 19:39475625-39475647 GTGGGGAAGAGGCAGGAGGCAGG + Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166075849 19:40413400-40413422 GGGGGGAAAAGGAATGGGGAGGG + Intergenic
1166160226 19:40947218-40947240 AGGAGGAAAAGGAAGGCGGAGGG + Intergenic
1166169116 19:41014854-41014876 AGTAGGAAAAGGAAGGAGGAGGG + Intronic
1166279900 19:41784963-41784985 GTAGGGAACAGGAAGGAGCAGGG + Intergenic
1166382787 19:42363358-42363380 CCAGGGAGATGGAAGGAGGAGGG - Intronic
1166412853 19:42568241-42568263 GTAGGGAACAGGAAGGAGCAGGG - Intergenic
1166589121 19:43980542-43980564 CTGGTGAGAAGGAAGCAGGAAGG + Intronic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1166911279 19:46160072-46160094 AAGGTGATAAGGAAGGAGGAAGG - Intronic
1167254406 19:48418655-48418677 CGAGGGAGAAGGAGGGAGGAAGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167292910 19:48634580-48634602 CTGGGAGGAAGGGAGGAGGAGGG - Intronic
1167502068 19:49854109-49854131 CTGGGGCAAAGGCTGGAGGTGGG + Intronic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1167792152 19:51689415-51689437 CGGGGAGAAGGGAAGGAGGATGG + Intergenic
1167901025 19:52622388-52622410 CTGGGGAAAGGGTAGAAGGTAGG - Intronic
1168052287 19:53838439-53838461 TTGGGGAAAAGGTGGGAGTAGGG + Intergenic
1168143879 19:54408430-54408452 GAGGGGAAAAGGAAGGAAGAAGG + Intergenic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168228485 19:55013607-55013629 CTTGGGAAAAGACAGAAGGATGG - Intergenic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168293486 19:55368441-55368463 CTGGGGACAAGGTGGGAGGCAGG - Intronic
1168311492 19:55463239-55463261 CTAGGCAGAAGGAAGGGGGAAGG + Intergenic
1168416747 19:56174238-56174260 CTGGGAAGGAGAAAGGAGGAGGG - Intergenic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1168485129 19:56755006-56755028 AAGGGGAAAATGAAGGAGAAAGG + Intergenic
1168497894 19:56869516-56869538 CTGGGGAAATGAAAGGAAGTGGG - Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168615688 19:57835159-57835181 ATGGGGTTAAGGGAGGAGGAAGG + Intronic
1168621095 19:57880289-57880311 ATGGGGTTAAGGGAGGAGGAAGG - Intronic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925121500 2:1421990-1422012 CTGGGGCAAGGGCAGGAGGGAGG - Intronic
925174344 2:1771714-1771736 GTAGGGAAAGGGAAAGAGGAAGG + Intergenic
925288964 2:2734026-2734048 CTGGGGTAGAGAAAGGAGGGTGG - Intergenic
925372931 2:3360909-3360931 ATGGGGAAAGGGGAGGGGGAAGG + Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925657892 2:6168940-6168962 CTGGAGAGAGGGAAGGAGGGAGG - Intergenic
925831891 2:7904016-7904038 CAGGAGAAAAGGGATGAGGATGG - Intergenic
925836520 2:7951996-7952018 ATGGGCAACAGGAAGGAGGCTGG - Intergenic
926061504 2:9807761-9807783 CTGGGGCAAAGGAAGGCACAGGG - Intergenic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926459276 2:13108985-13109007 CAGGGGAAAAGGTGGGAGAAGGG + Intergenic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927343558 2:22010226-22010248 GAGGGGAAAGGGAAGGGGGAGGG - Intergenic
927486416 2:23491408-23491430 CTTGGGAAAAGGCAGAGGGAAGG + Intronic
927908073 2:26876234-26876256 CTGGTGAACAGAATGGAGGAAGG + Intronic
928026785 2:27746614-27746636 ATGGGGTAAGGGAAGGAGCATGG + Intergenic
928250810 2:29677221-29677243 GAGGGGAGAAGGAAGGAAGAAGG - Intronic
928285578 2:29987406-29987428 CTGGGGAGAGGAGAGGAGGAAGG - Intergenic
928572943 2:32627123-32627145 CTGGGCAATAGGAAAGAGGGAGG - Intergenic
928667444 2:33564088-33564110 ATGGAGAAAAGAAAGGAGAAAGG - Exonic
929078554 2:38098739-38098761 GTGGGGAAAAGGCAGAAGGGGGG + Intronic
929081885 2:38129537-38129559 CTGAGAGAAAGGGAGGAGGAAGG - Intergenic
929187164 2:39107522-39107544 GGGGGGAAAAGGAAGGAGACAGG - Intronic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929599969 2:43198806-43198828 GTGGGGAAAGGAAAGGAGGTTGG - Intergenic
929776817 2:44935214-44935236 GAGGGGAAAAGGAAGAAGGTCGG + Intergenic
929906221 2:46048852-46048874 CTGGGAAGGAGAAAGGAGGAGGG - Intronic
929918544 2:46155783-46155805 GTGGGGAGAAGGATGGAGAAAGG - Intronic
929950297 2:46405128-46405150 CTGGGGATAAGGATGGAAGGAGG - Intergenic
930017437 2:46980667-46980689 CAGGGGAAATGGAAGGAGTCTGG + Intronic
930084063 2:47480221-47480243 AAGGGGGAAGGGAAGGAGGAAGG - Intronic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930102751 2:47615930-47615952 CTGGGGAAATGGATGAAGAAAGG - Intergenic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930637208 2:53819772-53819794 CTCGGGGAAAGAAAGGGGGAGGG - Intergenic
930654229 2:53992222-53992244 CTGGTGAAAAGAAGGAAGGAAGG - Intronic
931044385 2:58334002-58334024 CAATGGAAAAGAAAGGAGGAGGG - Intergenic
931108207 2:59080969-59080991 GTGAGGTAAAGGTAGGAGGAAGG + Intergenic
931152814 2:59593969-59593991 GTGGGGAAATGGAAGGTGGAGGG + Intergenic
931282694 2:60808010-60808032 TTGGGGAAAAGGTATGAGGCTGG + Intergenic
931291224 2:60875710-60875732 CTGGTGAAAAGAAAGGGGGAAGG - Intergenic
931405639 2:61974932-61974954 CAGGGGTTCAGGAAGGAGGAGGG - Intronic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931462810 2:62462978-62463000 CTGGGAAAAAGGAAAGAAGCTGG + Intergenic
931909972 2:66888722-66888744 TGGAGGCAAAGGAAGGAGGAAGG + Intergenic
932319468 2:70810795-70810817 CTGGGGAAAGTGAAGCATGAAGG - Intronic
932343653 2:70982142-70982164 CTAGGGAAAAGGCTGGGGGAGGG - Intronic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932654866 2:73601658-73601680 CTGGGGACAAGGCCGCAGGAGGG + Intronic
932876498 2:75457787-75457809 CTGGGGAAATGGGAAGATGAGGG - Intergenic
933024838 2:77243532-77243554 CTGGGGGAAAGGGAGAATGAGGG + Intronic
933226421 2:79754482-79754504 ATAGGGCAAATGAAGGAGGAGGG - Intronic
933505782 2:83175653-83175675 GTTCTGAAAAGGAAGGAGGAGGG - Intergenic
933775791 2:85770434-85770456 CTGGGGAAAAGGGGGGTGGGTGG + Intronic
933789647 2:85873463-85873485 GTGGGGACAAGGGAGGAGGGAGG + Intronic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933812626 2:86042593-86042615 CAGAGGGAAAGGCAGGAGGAAGG + Intronic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
934484262 2:94688062-94688084 CTGGGAAAAAGGAAGTAAGGTGG + Intergenic
934524578 2:95043748-95043770 CTGGGGGACAGGGCGGAGGAGGG - Intronic
934578985 2:95423221-95423243 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
934600462 2:95653482-95653504 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
934704659 2:96468531-96468553 GTGGGGAGAAGGAAGGGGAATGG - Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
935068449 2:99673299-99673321 GTGGGGAAAACCAAGCAGGAGGG + Intronic
935426627 2:102925722-102925744 CTGGGGAAAAAAAAGGAGAAAGG + Intergenic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
935566357 2:104612205-104612227 CACGGGAAAAGGCAGGAAGAGGG - Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
935883635 2:107592326-107592348 CGGGAGAGAAGGGAGGAGGAAGG - Intergenic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
936498295 2:113042487-113042509 CTGGTGAATAGGACGGGGGATGG - Intronic
936533820 2:113295543-113295565 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
936780882 2:116030757-116030779 AGGGGGAAAAGGAAGGAGGGAGG - Intergenic
936918099 2:117660774-117660796 CTGAGGAACAAGAAGGAGGCTGG - Intergenic
936928382 2:117761350-117761372 TTGGCCAAAAGGAAGGTGGAAGG - Intergenic
937094437 2:119226221-119226243 CTGGGGCAAGGGAAGGAAGCAGG + Intronic
937145029 2:119637236-119637258 CTGGGGCAAAGGTAGGGAGAGGG - Intronic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937307328 2:120880452-120880474 CGGGGAAGGAGGAAGGAGGATGG - Intronic
937980982 2:127615205-127615227 CCTGGGCCAAGGAAGGAGGAGGG + Intronic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938611142 2:132948775-132948797 GTGGGGAAAAGGCAAGAGAAGGG - Intronic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938675038 2:133624125-133624147 TTGGGGAAAAGGGTGGGGGATGG + Intergenic
938692865 2:133808271-133808293 CTGGGGACAAGGGACCAGGAAGG + Intergenic
938713813 2:134000457-134000479 CAGGGGAAAAGGAAGTCAGATGG + Intergenic
938739849 2:134220717-134220739 CTAGAGCAAAGGAAAGAGGAGGG - Intronic
938945192 2:136206049-136206071 CTGGGGAAAGGGTAGAAGAATGG - Intergenic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939284602 2:140112709-140112731 AGGGAGAGAAGGAAGGAGGATGG + Intergenic
939397913 2:141655100-141655122 CTGGGGAGGAGGAAGAGGGACGG + Intronic
939448608 2:142341957-142341979 CTGGGGAGAATGAAAAAGGATGG + Intergenic
939691686 2:145269830-145269852 CTGGAGAAAAGGAAAGGGGTTGG - Intergenic
939788593 2:146545480-146545502 TTGGGGAAAAGGTATGTGGATGG - Intergenic
940337907 2:152547690-152547712 AAGAAGAAAAGGAAGGAGGATGG - Intronic
940640007 2:156334690-156334712 CTGGGGAGAAGGAAGGGGGTGGG + Intronic
940861851 2:158778877-158778899 CTGGGGATTAGGAAAGAGGTTGG + Intergenic
940890873 2:159034205-159034227 CAAGGGAGAAGGCAGGAGGAGGG - Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941038211 2:160590557-160590579 AGGGGGAAGAGGAAGGGGGAGGG - Intergenic
941225117 2:162838766-162838788 GTGGGGAACGGGAAGGAGGCGGG + Intergenic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942128578 2:172853173-172853195 CTTCAGAAAATGAAGGAGGATGG - Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942248944 2:174031663-174031685 CTGCAGAAAAGTGAGGAGGAGGG - Intergenic
942784606 2:179686465-179686487 CTTGGGGAAAGGAAGGCTGAAGG + Intronic
943239502 2:185364887-185364909 CTGGAGAAAAGGCATGGGGATGG - Intergenic
943811846 2:192196345-192196367 CGGGGGGAGAAGAAGGAGGAGGG - Intergenic
943834659 2:192503626-192503648 CTGGAGATAAGGGAGGAAGAAGG + Intergenic
944247877 2:197550627-197550649 CTGGGGAAAGTGAAGCATGAAGG + Exonic
944404815 2:199371947-199371969 CTGTGAAAAAGAAAGGATGAGGG + Intronic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
945045074 2:205774708-205774730 CTGGGGAATAGGTGGGAGGTGGG - Intronic
945121169 2:206458766-206458788 TTGGGGAAAAGAGAGGAGGTGGG - Intronic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
945259733 2:207832342-207832364 GGGAGGAAAAGGAAGGAGAAAGG + Intronic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945564175 2:211375990-211376012 ATGAGGGAAAGGAAGGAGGATGG + Exonic
945701761 2:213179256-213179278 TTGGGGAAAGGGCAAGAGGAAGG + Intergenic
946135131 2:217639694-217639716 CGGAAGGAAAGGAAGGAGGAAGG + Intronic
946193246 2:218018690-218018712 CTGGGGAACAGGAAGGAGTCTGG + Intergenic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946355581 2:219182391-219182413 CTGGGGAACAGGTGGGAGAATGG - Exonic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947228614 2:227863426-227863448 CTGGGTAGAAGGGAGAAGGAGGG + Intergenic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
948338254 2:237228336-237228358 CAGGAGAAAAGGAGGGAGTATGG + Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948756950 2:240165539-240165561 CCTGGGAAGTGGAAGGAGGATGG + Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948913067 2:241015048-241015070 CTTGTGAAAAGCAAGGTGGAAGG - Intronic
1168821443 20:776036-776058 CTCGGGGAAAGGCAGGCGGAGGG + Intergenic
1168876099 20:1173341-1173363 TTGGGGATCAGGGAGGAGGAGGG - Intronic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1169010671 20:2247498-2247520 TTTGAGAAAAGGAAGGATGAAGG - Intergenic
1169206403 20:3742540-3742562 CTGGGGTAAAAGTTGGAGGATGG + Intronic
1169316293 20:4593309-4593331 CAGGGGCACAGGAAGAAGGAGGG - Intergenic
1169428479 20:5514268-5514290 GTGGGGATAAGGAAAGTGGAAGG + Intergenic
1169431825 20:5543058-5543080 TTTGGTAGAAGGAAGGAGGAAGG + Intergenic
1169499702 20:6147717-6147739 CTGGGGATAATGAATAAGGAAGG + Intergenic
1169975218 20:11317994-11318016 TTGGGGAAAGGGTGGGAGGAGGG - Intergenic
1170329569 20:15193716-15193738 CTGGGGAAATGAGAGGATGAGGG - Intronic
1170405645 20:16032853-16032875 ATGAGGAAAAGGTAAGAGGAAGG + Intronic
1170429562 20:16263904-16263926 CTGAGGAAAAGGAAGCAAGCAGG - Intergenic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1170629205 20:18053960-18053982 CTGGGGAGAAGGGAGGCGGGTGG - Intronic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1170987687 20:21273614-21273636 CTGGGGGAGAGCATGGAGGAGGG - Intergenic
1170995685 20:21355219-21355241 CTGGGGAGAAAGGAGGAGTAGGG - Intronic
1171209885 20:23309194-23309216 ATGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171209899 20:23309233-23309255 GTGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171209913 20:23309272-23309294 GTGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171209927 20:23309307-23309329 GTGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171338278 20:24407743-24407765 GAGGGGAAAAGGAGGGAGCATGG + Intergenic
1171358911 20:24572828-24572850 CAGGGGTTAAGGATGGAGGAAGG + Intronic
1172184618 20:33023604-33023626 GTGGGGCAGAGGAAGGAGGGGGG - Exonic
1172187138 20:33038000-33038022 TTGGACAAAAGGAAGGTGGATGG - Intronic
1172221515 20:33277464-33277486 CAGGGGCAAAGGAAGGAGGGTGG - Intronic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172302218 20:33858136-33858158 GGGAGGAAAGGGAAGGAGGAAGG + Intergenic
1172428071 20:34869539-34869561 CTGGGCAAGAGGGAGGAGGCAGG + Intronic
1172773460 20:37394596-37394618 CTGGGGAAGAGGAAGAAGCGGGG - Intronic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173019838 20:39257946-39257968 CCGGGGAAAAGAGTGGAGGATGG - Intergenic
1173037166 20:39423467-39423489 CTAGGGAAAAGGAATGAAGTTGG - Intergenic
1173186309 20:40843215-40843237 AAGGTGAGAAGGAAGGAGGAAGG - Intergenic
1173300052 20:41794474-41794496 TTGGGGAGAAGGAAGGAGGGAGG - Intergenic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174079879 20:47963056-47963078 GTGGGGAAAAGAAGGGAGGGAGG - Intergenic
1174808248 20:53623460-53623482 CTGAGGAGAAGGACGGAGGGTGG + Intergenic
1174976012 20:55335282-55335304 CTGGGGAAAAGGATATGGGATGG - Intergenic
1175104227 20:56602985-56603007 CTGGGAAAAAGCCAGGAAGATGG + Intergenic
1175261630 20:57678196-57678218 CTGGGGAAAGGTAAGGTTGATGG + Intronic
1175298807 20:57928507-57928529 GAGGAGAAAAGGGAGGAGGAAGG - Intergenic
1175402541 20:58708720-58708742 CTGGGCAGAGGCAAGGAGGAGGG - Intronic
1175554342 20:59837449-59837471 CTGAGGCAAAGAAAGGAGGGAGG - Intronic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175733627 20:61370915-61370937 CGGGGGAAAGGGAGGGAGAAAGG - Intronic
1175754877 20:61523130-61523152 CTAGGGAGAGGGATGGAGGATGG - Intronic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1176000328 20:62828741-62828763 CTGGGGACAAGGGATGAGTAAGG - Intronic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1176270389 20:64233154-64233176 GGAGGGAAAGGGAAGGAGGAAGG - Intronic
1176546533 21:8204703-8204725 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176554427 21:8248894-8248916 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176565484 21:8387750-8387772 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176573349 21:8431918-8431940 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176665920 21:9687650-9687672 CTGGGAAAAAGGAAAGACAAAGG - Intergenic
1177623402 21:23626429-23626451 GTGGGGAATAGGAAGGATCATGG - Intergenic
1177648689 21:23933469-23933491 ATGAGGAAAGGAAAGGAGGATGG - Intergenic
1177779449 21:25607291-25607313 GCGGGGCAGAGGAAGGAGGAGGG - Intronic
1177903869 21:26951476-26951498 CTAGTAAAAAGGAAGGGGGATGG + Intronic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178434480 21:32545909-32545931 CTAGGGAAAGGGAAGGAAGAAGG - Intergenic
1179068665 21:38051385-38051407 CTGTGCAAAAGAAAGGAGGAGGG - Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1179312026 21:40205023-40205045 AGGGGGAAATGGAAGGAGCAAGG + Intronic
1179474422 21:41634220-41634242 GCCGGGAGAAGGAAGGAGGAGGG - Intergenic
1180729280 22:17969535-17969557 CAGGGAAGAAGGAAGAAGGAAGG - Intronic
1181309816 22:21938519-21938541 CCGGGGAAAAGGAACAAGGTGGG - Intronic
1181442736 22:22945032-22945054 CAGGTGACCAGGAAGGAGGAGGG + Intergenic
1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG + Intronic
1181856952 22:25788712-25788734 AGGAGGAGAAGGAAGGAGGAGGG - Intronic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182373462 22:29828736-29828758 ATGGGGAAAGGGTGGGAGGAAGG + Intronic
1182559563 22:31149096-31149118 CCAGGGAAATGGAAAGAGGAAGG + Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182692058 22:32171102-32171124 TTGGGGGATAGGGAGGAGGATGG + Intergenic
1182810945 22:33116185-33116207 CTGCGGGAAAAGAAGGTGGATGG - Intergenic
1182865465 22:33600580-33600602 ATGGGGGAAAGGAAGGAGGTTGG + Intronic
1182892670 22:33832013-33832035 CTGGGTGAAAGGAAGAAGGGAGG - Intronic
1183034860 22:35133921-35133943 ATGGAGACAAGGGAGGAGGAAGG + Intergenic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183188151 22:36304301-36304323 ATAGGGAACAGGAAGAAGGAGGG - Intronic
1183405787 22:37629973-37629995 GTGGGGAAAAGGATGCAGGTGGG - Intronic
1183463597 22:37967958-37967980 CTGGGGAACAGGGAGATGGAGGG - Exonic
1183467042 22:37985030-37985052 CCTGGGAAAAGGTAGGAGGCAGG - Intronic
1183505762 22:38208025-38208047 CTTGGGTAAAGGGAGGAGGCAGG + Intronic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183646680 22:39131289-39131311 CTGGGGGAAAGAAAGGCAGATGG + Exonic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1184387863 22:44186521-44186543 TGAGGGAATAGGAAGGAGGATGG - Intronic
1184638378 22:45854394-45854416 GGGGGGAAAAGGGAGGTGGAGGG + Intergenic
1184770291 22:46593259-46593281 CCGGGGAAAAGGAACCAGGCAGG - Intronic
1185088077 22:48751397-48751419 CTCAGGAAAATGAAGGAGGCTGG - Intronic
1185143584 22:49117266-49117288 CTGGGGAAAAGCCAGGGGCAGGG + Intergenic
1185173451 22:49306290-49306312 CTGGGGATTAGGCAGGAGGGAGG + Intergenic
1185176905 22:49333025-49333047 CTGGGGGCAAGGGAGGAGGCAGG + Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1203251396 22_KI270733v1_random:120965-120987 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203259442 22_KI270733v1_random:166039-166061 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
949638992 3:6014145-6014167 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
949723008 3:7012544-7012566 CAGGGGAGAAGGATGGGGGAAGG - Intronic
949930833 3:9077230-9077252 CTGAAGCAAAGGAGGGAGGAGGG - Intronic
950320427 3:12047387-12047409 CTGAGAAGAAGGAAGGATGATGG + Intronic
950545793 3:13637234-13637256 AGAGGGAAAAGGAAGGAGAAAGG + Intronic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950799141 3:15535216-15535238 CTGGGGAAGAGAGGGGAGGAGGG + Intergenic
950912305 3:16606744-16606766 CTTAGGAAAAGGATGGAGTAGGG + Intronic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
951670891 3:25180754-25180776 TAGGGGAGAAGGAAAGAGGAAGG + Intronic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
953042944 3:39271075-39271097 TTGGGAAAAAGGAATGGGGAAGG - Intronic
953190174 3:40678585-40678607 ATTGGGAAAAGGAAGCAGGATGG - Intergenic
953869656 3:46615391-46615413 GTGTGGAAAATGAAGGAGAAGGG - Intronic
953903678 3:46857625-46857647 AGGGAGAAAAGGAGGGAGGAAGG + Intergenic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
953968209 3:47326532-47326554 TGGGGGAAAAGGAAGGAGAGCGG - Intronic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954544390 3:51420302-51420324 CTGGGGTAAAGGCAGAAGAATGG + Exonic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954661435 3:52228949-52228971 CTGGAGCCCAGGAAGGAGGATGG + Exonic
954733848 3:52688396-52688418 TTGGTGAAAAGGTGGGAGGAGGG - Intronic
954952064 3:54484270-54484292 ATGGAGAATAGGAAGGAGAATGG - Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955143997 3:56298174-56298196 CTGGGGAAAGGGAGGGAGATGGG - Intronic
955356844 3:58238413-58238435 CTGGGGAAAGGGAAGCTGAAAGG - Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956313954 3:67913816-67913838 AGGGGAAAAGGGAAGGAGGAGGG - Intergenic
956383013 3:68686049-68686071 CTGGGGGAAAGGATGGTGGTGGG - Intergenic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956619210 3:71203923-71203945 TCATGGAAAAGGAAGGAGGAAGG + Intronic
956665418 3:71637553-71637575 AGGGGGAAAAGGGAGAAGGAAGG + Intergenic
956741408 3:72279166-72279188 GGAGAGAAAAGGAAGGAGGAGGG + Intergenic
956935513 3:74096469-74096491 CTGGGGAAAAGGAAAATGTAAGG - Intergenic
956985376 3:74693218-74693240 CTAGGGAGAAGGTAGGTGGAAGG + Intergenic
957040412 3:75331768-75331790 CTGGGGAGAAGGACAAAGGAGGG - Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
958020753 3:87992335-87992357 CTGAGCAAAAGGGAGGGGGAAGG + Exonic
958795374 3:98701516-98701538 GTGTGGAAAAGGGAGGAAGAAGG + Intergenic
958833545 3:99117654-99117676 TTGGGCAATAGGAAGGAAGAAGG + Intergenic
958999828 3:100950572-100950594 CTGAGGAAAAGTAAAGATGAAGG + Intronic
959160677 3:102720923-102720945 GTGGGGAATAGGAAGGAGACTGG - Intergenic
959498588 3:107079168-107079190 CTGGGGCAGAGGAAGGAGGCAGG + Intergenic
960335611 3:116414006-116414028 AGGTGGAAAAGGAAGGAGGCAGG + Intronic
960452069 3:117822305-117822327 TGGGGGAAAGGGAGGGAGGAAGG + Intergenic
960822865 3:121752891-121752913 GGGGGGAAAAAGAAGAAGGAAGG + Intergenic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
961175075 3:124828497-124828519 CTGGGGTAAGGGAGGCAGGAGGG + Intronic
961205348 3:125077022-125077044 CTGGAGAGAAGGAAGGATGATGG + Intergenic
961243623 3:125433415-125433437 TTAGGGAAAAGGAATGAGGCTGG - Intergenic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
961311909 3:126007681-126007703 TTGGGGAGAAGGAAGGAGCTGGG - Intronic
961372802 3:126441575-126441597 CTGGGAAAAAGGGAGGAGCTGGG + Intronic
961779281 3:129312217-129312239 CTGGGAAAAAGGGAGGGGAAGGG + Intergenic
962089830 3:132231307-132231329 CTGGGGAAAGCGAAGGAATAGGG - Intronic
962747845 3:138410797-138410819 CTGGGGAACTGGGAGGAGAAGGG - Intergenic
962791380 3:138814616-138814638 GTGGAGGAAAGGAAGGTGGAGGG - Intronic
963444246 3:145383345-145383367 AAGGAGAAAAGGAGGGAGGAAGG + Intergenic
963646734 3:147924048-147924070 CAGAGGAAAAGTAAGGAGTATGG - Intergenic
963790505 3:149577994-149578016 GTGGGGGGAGGGAAGGAGGAAGG - Intronic
963806531 3:149728493-149728515 CTGGGGGATAGGCAGAAGGAAGG + Intronic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
964342162 3:155719162-155719184 CAGGGGAAAGGGTAGAAGGAGGG - Intronic
964591027 3:158361806-158361828 AGGGGGAAAAGGAAGAAAGAAGG - Intronic
964602832 3:158521358-158521380 CTGGGGATAAGGCAGGACAAGGG - Intronic
964704030 3:159599404-159599426 TTGGGGAAAGGGCAGGAGGTGGG - Intronic
964814277 3:160700494-160700516 TTGGGGGGAAGGAAGAAGGATGG + Intergenic
964942665 3:162178301-162178323 CTGGGGGAAAGTAGGGTGGAGGG + Intergenic
964972867 3:162582841-162582863 CTGGAGACAAGGAAGGGGCAAGG + Intergenic
966218455 3:177527044-177527066 CTGGGGTAGAGGAAGAAGGCTGG - Intergenic
966445776 3:179999189-179999211 TTGGGGAAAAGGTATGTGGATGG + Intronic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
966916674 3:184588067-184588089 CTGGGAAGAAGGCAGGAGCAGGG - Intronic
966924439 3:184635236-184635258 GTCGGGAAGAGGGAGGAGGAGGG + Intronic
967102603 3:186228665-186228687 CCGGGGAAATGCTAGGAGGAGGG - Intronic
967301925 3:188022609-188022631 CAGGGGAAAAGGCAGGATGGAGG - Intergenic
967831813 3:193926253-193926275 CTGGGGAAGAGAAAGCAGGGTGG - Intergenic
968193337 3:196686916-196686938 ATGGGGAAAAGGCAGGAAGGAGG - Intronic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968448048 4:662335-662357 CAGGGCAGAAGGATGGAGGAGGG + Intronic
968652501 4:1765846-1765868 GTGGGGAGAAGGGAGGAGGGAGG + Intergenic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969032133 4:4223977-4223999 GTGGAGAGAAGGATGGAGGAAGG + Intronic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970433168 4:16007686-16007708 AGGGGGAAAAGGAAGGGAGATGG + Intronic
970535506 4:17026390-17026412 CTGGGGAAAAGCTAAGAGGCAGG + Intergenic
970754654 4:19410808-19410830 TTTGGGGAAAAGAAGGAGGAAGG + Intergenic
970837044 4:20421817-20421839 ATGGAGAAAGGGAAGGAGGGAGG - Intronic
971393714 4:26209662-26209684 AGGGGGAGACGGAAGGAGGAAGG - Intronic
971393747 4:26209758-26209780 GGGGGGAGAGGGAAGGAGGAAGG - Intronic
971393765 4:26209807-26209829 GGGGGGAGAGGGAAGGAGGAAGG - Intronic
971408258 4:26342520-26342542 ATGGGAGAAAGGAATGAGGAGGG - Intronic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
972874621 4:43343445-43343467 ATGAAGGAAAGGAAGGAGGAAGG - Intergenic
972909408 4:43796580-43796602 AAGGGGAAAAGGAAAAAGGAAGG + Intergenic
973397804 4:49611545-49611567 CTGGGGAAAAGGCAGGAAACAGG - Intergenic
973554059 4:52064422-52064444 TGGAGGGAAAGGAAGGAGGAGGG - Intronic
973721110 4:53724532-53724554 GTGGGGAGGAGGAAGGAGGGAGG - Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974283098 4:59824750-59824772 CTGGAGAAAAGAAAGGAGGGTGG - Intergenic
974842304 4:67311755-67311777 ATTGGGAAAAGGAAGGGAGAAGG - Intergenic
975029626 4:69599562-69599584 ATGGAAGAAAGGAAGGAGGAAGG + Intronic
975642934 4:76518460-76518482 CAGGCAAAAAGGAAGGAGGGGGG - Intronic
975948976 4:79745027-79745049 CCGGGGGGAAGGAAGGAGGGAGG - Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976988717 4:91336052-91336074 CTGCTGAGAAGAAAGGAGGAGGG + Intronic
977058535 4:92225183-92225205 CTGTTGAATAGGAAGGAGGGAGG + Intergenic
977116026 4:93030236-93030258 CGGGAGAAAAGGAAAGAGGAAGG - Intronic
977218161 4:94307925-94307947 TTGGTGAAAAGGAAGCAGAAAGG + Intronic
977292831 4:95181763-95181785 CTGTGGGAAAGAAAGAAGGATGG + Intronic
977872753 4:102112650-102112672 CAGGGGAGAAGGAAGGATAAAGG + Intergenic
978196470 4:105978271-105978293 ATGGAAGAAAGGAAGGAGGAAGG + Intronic
978411778 4:108433927-108433949 CGGAGGAAAAGGAAGGAAGCAGG + Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978724540 4:111955137-111955159 ATCAGGAAAAGGAAAGAGGAGGG - Intergenic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
978780925 4:112553185-112553207 ATGGGGAAAAGCAATGGGGATGG - Intronic
979798002 4:124871266-124871288 ACTGGGAAAAGGTAGGAGGAAGG - Intergenic
979999280 4:127469823-127469845 TTTGAGAAAAGAAAGGAGGAAGG + Intergenic
980092331 4:128455623-128455645 GAGGGGGAAGGGAAGGAGGAAGG + Intergenic
980252018 4:130329334-130329356 CAGGGAAAAAGAAAGTAGGAAGG + Intergenic
980644087 4:135619181-135619203 CTGGAGAAGAGGCAGGAGGTGGG - Intergenic
980940339 4:139268120-139268142 AAGGGGGAAAGGAAGGGGGAAGG + Intronic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981424133 4:144584146-144584168 CTGGTGAGAAGGATGGAAGAAGG - Intergenic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981545775 4:145891901-145891923 CTGGGGAATAGCAAGAAGCAGGG - Intronic
981616885 4:146651806-146651828 AGGGGAAAATGGAAGGAGGAAGG - Intergenic
981873624 4:149515829-149515851 TTGGGGAAAAGGTATGTGGATGG + Intergenic
982117230 4:152107746-152107768 CTGGACAAAAGGAAGGGGCAGGG + Intergenic
982235633 4:153249089-153249111 GTGGGGAAGAGGAGGGAGTAAGG - Intronic
982543819 4:156708879-156708901 CTAGGGAAAAGGCATGAGAATGG - Intergenic
982744108 4:159088438-159088460 CTGGGGGAAGGAAAGGAGCAGGG + Intergenic
983486226 4:168333954-168333976 CTGGGGAATTGGATTGAGGAAGG - Intergenic
984276173 4:177612628-177612650 CTGGGCAAAAGGAACTGGGAAGG + Intergenic
984502509 4:180574035-180574057 ATGGGCAAAAGGAAGAAGCAGGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985102340 4:186470865-186470887 AAGGGGAAAAGGAGGCAGGAGGG + Intronic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
985411650 4:189691909-189691931 CTGGGAAAAAGGAAAGACAAAGG - Intergenic
985548790 5:523044-523066 CTGCGGAGAAGGGAGGAGGCGGG + Intronic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
985855240 5:2419214-2419236 CTGGGGAAAGGGGAGGGAGAAGG + Intergenic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
985993767 5:3584889-3584911 ATGGGAGAAAGGAAGGAGGGAGG + Intergenic
985993802 5:3585033-3585055 ATGGGAGAAAGGAAGGAAGAAGG + Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986404936 5:7416226-7416248 CTTGGGCAAAGGGAGGAGGCTGG + Intronic
986407719 5:7443094-7443116 CTGTGGAAAAGGAAAGATGGAGG - Intronic
986621384 5:9679199-9679221 CAGGGGGAAAGGAAGGATAATGG + Intronic
986682694 5:10248650-10248672 CTGGGGCTGAGGCAGGAGGATGG - Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988698665 5:33650082-33650104 CTGATGAAAAGGGAGAAGGAAGG - Intronic
988846730 5:35135208-35135230 CTAAGGAAAAGGCATGAGGAAGG + Intronic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
988964713 5:36404392-36404414 CTAGGGAAGTGGAAGGAGTAGGG - Intergenic
989102816 5:37837102-37837124 CGGGGGAAAAGGGGGGAGGTTGG + Intronic
989235354 5:39141907-39141929 CTGGAGAAAAGGAAGGAGTCAGG - Intronic
989351660 5:40493802-40493824 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
989561683 5:42859284-42859306 TTGGGGAAAGGGCAGGAGGTGGG - Intronic
989668214 5:43881925-43881947 CTGACAAAAAGGAAGGAGCAAGG + Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990346248 5:54874586-54874608 CTGGGGAAAAGCAAGGAACTAGG + Intergenic
990449598 5:55922273-55922295 CTGGGGAGAAGCAAGGGGCAGGG + Intronic
990616157 5:57510703-57510725 GAGGAGGAAAGGAAGGAGGAGGG - Intergenic
990642795 5:57806709-57806731 CTGGAGAAAAGAAAGGCAGAAGG + Intergenic
991329847 5:65482187-65482209 CTTGGAAAAATGAAGGGGGAGGG + Intergenic
991522206 5:67513735-67513757 CTGGGGAACAGGAAGCATCAAGG - Intergenic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
991946172 5:71900405-71900427 CTGGGGAAAAGAAGGCAGGGTGG - Intergenic
991963713 5:72070694-72070716 CTGGAGAATAGCAAGGAGCAGGG + Intergenic
992756309 5:79909897-79909919 CTGGGGAAAAGGCATGAGAAGGG - Intergenic
992868009 5:80977166-80977188 CAGGTAAACAGGAAGGAGGATGG - Intronic
992996551 5:82339730-82339752 CCTGGGAGAAGGTAGGAGGATGG + Intronic
993066512 5:83105382-83105404 CTGGGGCAGAGGAAGGAGATTGG + Intronic
993234686 5:85289304-85289326 GTGGGGAAGAGGAGGAAGGAAGG + Intergenic
993302918 5:86235595-86235617 ATGAGGAAAAGGATGGGGGAAGG + Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993387623 5:87278869-87278891 CAGGGAATAAGGAAAGAGGAAGG - Intronic
993475364 5:88357754-88357776 AGGGGGTACAGGAAGGAGGATGG + Intergenic
993532707 5:89043873-89043895 CTGATGATAAGGAAGGAGGCAGG - Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994134818 5:96274042-96274064 CTTGGGAAAAGGGAGATGGAAGG + Intergenic
994372734 5:98985775-98985797 AAGGGAAAAAGAAAGGAGGAAGG + Intergenic
994513694 5:100742256-100742278 TGGGGGAAAAGGAGGGAGGGGGG + Intergenic
994553891 5:101272057-101272079 CAGGTGGAAAGGAAGGAGAAAGG + Intergenic
995109627 5:108414475-108414497 AAGGGGAAAAGGGAGGGGGATGG - Intergenic
995114249 5:108461232-108461254 CTGGAGAAAAGCAGGTAGGAGGG - Intergenic
995269525 5:110205201-110205223 CTGGGGGAAAGAAGGCAGGATGG + Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995623978 5:114056611-114056633 CTGGAGAAAAGTAAGCAAGAGGG - Intergenic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
996016005 5:118534660-118534682 CTGGGGAAACGGGAAGTGGAGGG - Intergenic
996339367 5:122419041-122419063 CAGGGGTCAAGGAAGGAGAAGGG + Intronic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996629701 5:125612682-125612704 CTAGAGAACAGGAAAGAGGAAGG + Intergenic
996786256 5:127239892-127239914 CTGGGTAGAAGTAAGGATGAGGG - Intergenic
996823939 5:127660289-127660311 CTCTGGACAAGGAAGGAGGCAGG - Intergenic
996860705 5:128062544-128062566 CAGGTGAAAGGGAAGTAGGATGG + Intergenic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997379127 5:133422624-133422646 GTGGGGAAAATCAAGGAGGGAGG + Intronic
997596133 5:135108525-135108547 CCAGGGAAGAGGAAGGAGTAAGG - Intronic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
997952083 5:138250293-138250315 AGGGGAAGAAGGAAGGAGGAAGG + Intergenic
997979633 5:138460830-138460852 CTGGGGAAAATGAGGCTGGAAGG - Intergenic
998102923 5:139449193-139449215 CTGGGTTAAAGAGAGGAGGAGGG + Intronic
998416185 5:141947835-141947857 TTGGGGGTAAGGAAAGAGGAGGG - Intronic
998511842 5:142720332-142720354 GTGGCGATAAGGCAGGAGGAAGG + Intergenic
998651995 5:144131190-144131212 CTTTGGAAAATGAAGGAAGAAGG + Intergenic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999087060 5:148902271-148902293 CTGGGGACAAGCAAGAAAGAGGG - Intergenic
999126735 5:149251568-149251590 CAGGGGAAAAGGGAGGGGGTGGG - Intronic
999429153 5:151511093-151511115 CTGGAGAACAGGGAGGAGGCTGG + Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999480735 5:151945883-151945905 CTTGGGAAAAGAAAGGAAAAAGG + Intergenic
999795497 5:154985638-154985660 GTGGGGAAAAGAAAGATGGATGG + Intergenic
999928734 5:156407721-156407743 GTGGGGGAAATAAAGGAGGAAGG + Intronic
999965099 5:156800881-156800903 AAGGGGAAAAGCAAGCAGGAGGG + Intergenic
1000104319 5:158044415-158044437 TTGGGGAAAGGGCAGGAGGGGGG + Intergenic
1000283048 5:159798857-159798879 CTTGGGAGAAGGAGGGAGAAGGG - Intergenic
1000373978 5:160562317-160562339 TTAAGGAAAAGGAAGGAGGTTGG - Intergenic
1000495138 5:161972936-161972958 CTGAGGAAAAGAAAGGAGGCTGG + Intergenic
1000841048 5:166219049-166219071 GAGGGGAAAAGGAAGGAAGGAGG + Intergenic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001546002 5:172570869-172570891 ATGGAAAAAAGGAAGGAGGGAGG + Intergenic
1002061467 5:176628290-176628312 CTGGGGAGGAGGCAGGAGGGAGG + Intronic
1002100990 5:176857556-176857578 CTCAGGAATAGCAAGGAGGAGGG - Intronic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002782828 6:380116-380138 CTGGAGAAAAGGGAGGCTGAAGG - Intergenic
1002821307 6:727468-727490 GGGGAGAGAAGGAAGGAGGAGGG - Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003334929 6:5161792-5161814 CTGAGGAGAAGGAAAGACGAAGG + Intronic
1003372184 6:5539137-5539159 ATGGGGGAAAGGAAGGCTGATGG - Intronic
1003647372 6:7924709-7924731 CTGGGGAGAAGGCAAGAGCATGG + Intronic
1003863592 6:10343786-10343808 CAGGGGAACAGGTAGGGGGAAGG - Intergenic
1004061710 6:12204381-12204403 CGGGGGAAAGGGAGGGAGAAAGG - Intergenic
1004469087 6:15912594-15912616 CAAGAGAAAAGGAAGGAAGAAGG - Intergenic
1004545426 6:16593573-16593595 CTGGAGAGAAGGCAGGAGGATGG - Intronic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1004732345 6:18370138-18370160 GTGGGGAAAAGTGAGTAGGAGGG + Intergenic
1004926123 6:20416708-20416730 TTTGGGAAAAGAAAGGAGTAGGG + Intronic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005214064 6:23504429-23504451 CAGGAGAACAGAAAGGAGGAAGG - Intergenic
1005369922 6:25121791-25121813 AAAGAGAAAAGGAAGGAGGAAGG + Intergenic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1005887679 6:30109178-30109200 GTGGGGAGAGGGGAGGAGGATGG - Intronic
1005891274 6:30140730-30140752 GTGGGTTGAAGGAAGGAGGAAGG + Intronic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006001584 6:30969341-30969363 CTGGGGAAGAGAAAGCAGGGTGG - Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006384164 6:33719891-33719913 TTGGTGAGAAGGAAGGAGGGAGG + Intergenic
1006411737 6:33877858-33877880 CTGGGGGAGAGGCAGGAGAAGGG - Intergenic
1006527376 6:34618561-34618583 CCATGGAACAGGAAGGAGGAGGG - Intronic
1007036230 6:38676695-38676717 TTTGGGAAAGGGGAGGAGGAAGG - Exonic
1007130303 6:39466233-39466255 AAGGAGAGAAGGAAGGAGGAAGG - Intronic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007533627 6:42564654-42564676 CTGGGGGAAAGGAGGTATGATGG - Intronic
1007582970 6:42970109-42970131 GTGGGGAAAAGGAATGCAGATGG + Intronic
1007654908 6:43446042-43446064 CTGGGGACAAGGGATGGGGAAGG + Intronic
1007745918 6:44042839-44042861 CTGGGGAAAAGGGAGAAGCTGGG + Intergenic
1007864710 6:44955721-44955743 CAGGGGAAAGGGTAGGAGGGGGG + Intronic
1008340360 6:50356996-50357018 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1008394839 6:50994325-50994347 CTAGGGGTAGGGAAGGAGGAAGG + Intergenic
1008455196 6:51702425-51702447 CAGGGGAAAAGATAGGAGGCAGG + Intronic
1008455699 6:51708221-51708243 ATGAGGAAAAGAGAGGAGGAGGG - Intronic
1008916795 6:56796777-56796799 AGGGAGAGAAGGAAGGAGGAAGG + Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1009653135 6:66502440-66502462 CTGGTGAAAAAAAAGAAGGAAGG + Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1010158446 6:72822962-72822984 CTCGTAAAAAGGAAGCAGGAGGG - Intronic
1010887421 6:81261880-81261902 GAGGGGAAGAGGAAGGGGGAGGG + Intergenic
1010995861 6:82531677-82531699 GTGGGAGAAAAGAAGGAGGATGG + Intergenic
1010999154 6:82568352-82568374 AAGGGGAAAAGGAAGGAGTGGGG + Intergenic
1011040393 6:83023727-83023749 TTGGAGAAAAGGCAGGGGGAGGG + Intronic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011240897 6:85270365-85270387 CAGAGGAAAAGGAATGATGATGG - Intergenic
1011449321 6:87476042-87476064 CTGGGAATAAGGAAGTATGAGGG + Intronic
1011490291 6:87884566-87884588 TTGGAGAAAAGGCAGGATGAAGG + Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011565114 6:88665422-88665444 CTTGGGAACAGGTAGGAGGGGGG - Intronic
1011823444 6:91279142-91279164 CTGGGGAAGAGTGTGGAGGAGGG - Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012042978 6:94234048-94234070 ATGGGGAGCAGGAAGGGGGATGG - Intergenic
1012056296 6:94415356-94415378 CAAGGCAAAAGGAAGGAGTAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012204631 6:96445304-96445326 TAGGGGAAAGGGTAGGAGGAAGG + Intergenic
1012270888 6:97209030-97209052 CCTGTGATAAGGAAGGAGGAGGG - Intronic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012545555 6:100415069-100415091 CTAGGGAAAAGGCAAGAGGAGGG + Intronic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1013821145 6:114154691-114154713 CTTGGGGGAAGGCAGGAGGAGGG + Intronic
1013998667 6:116340008-116340030 CTGAGAAAAAGGATTGAGGAAGG + Intronic
1014011200 6:116477903-116477925 CGGGGGAAAAGGTAGGAGAGGGG - Intergenic
1014078924 6:117266639-117266661 CTGAGGAAATGGAAGGAAAATGG - Intronic
1014263055 6:119241865-119241887 CTGGGGGAAGGGAAAGATGAAGG + Intronic
1014645237 6:123965023-123965045 CTGGGTAAAAGGAAGATCGATGG - Intronic
1014748457 6:125228211-125228233 TTGGGGGAAAGGAAAGAAGAGGG + Intronic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1015054263 6:128881115-128881137 CTGGGAAAATGTAAAGAGGAAGG + Intergenic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015385101 6:132613369-132613391 ATGAGGAAAAGCAGGGAGGAAGG - Intergenic
1015475321 6:133653896-133653918 CTGAAAAAAAGGTAGGAGGAAGG - Intergenic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1015549368 6:134396096-134396118 CGGGGGAGAGGGAGGGAGGAAGG - Intergenic
1015562710 6:134533807-134533829 CTGGTGAAAAGGTAGGTTGATGG + Intergenic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016070515 6:139733067-139733089 ATGGGGAGAGGGAAGCAGGAAGG + Intergenic
1016200613 6:141403081-141403103 GTGGGAAATAGGAAGGAGTAAGG - Intergenic
1016541223 6:145167941-145167963 CTGATGAAAAGGAAGAAAGACGG + Intergenic
1016576177 6:145571959-145571981 TTGGGGAATAGGTAGGTGGATGG - Intronic
1016941280 6:149484705-149484727 CCGGGGCAGAGGCAGGAGGAGGG - Intronic
1016958971 6:149653522-149653544 CTGGTGAAAAGAGAGGGGGAGGG - Intergenic
1017019360 6:150127827-150127849 CTTGCAAAAAGGAAGGTGGAGGG - Intergenic
1017071131 6:150576411-150576433 CTGGCGTATGGGAAGGAGGAAGG + Intergenic
1017484810 6:154892681-154892703 CAGGGGAAAAGAAAGGATGGGGG - Intronic
1017616323 6:156250413-156250435 CTAGGGAAAGGGAAGGAAGGAGG - Intergenic
1017737871 6:157380749-157380771 CTGGGGAGGAGGAAGAAGGGAGG + Intergenic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1017950838 6:159133317-159133339 CTGGAGAAAATGAAGGTGTAAGG - Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018064577 6:160116347-160116369 CAGTGGAAAAGGAAGGATGCAGG + Intergenic
1018140544 6:160829681-160829703 AGGGAGAAAGGGAAGGAGGAGGG + Intergenic
1018304356 6:162439315-162439337 GAGGGGTAAAGGAAGGGGGAAGG - Intronic
1018534941 6:164809870-164809892 TTGGGGAACAGGTAGGTGGATGG - Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018607958 6:165618453-165618475 CTGGAGAAGAGGAAGGCTGATGG - Intronic
1018780043 6:167055007-167055029 CTGGAGACAGGGGAGGAGGAAGG + Intergenic
1018796565 6:167190061-167190083 CTGAGGAAGAGCAAGGAGGCCGG + Intronic
1018819754 6:167365056-167365078 CTGAGGAAGAGCAAGGAGGCCGG - Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019684301 7:2372260-2372282 ATGGAGAAAAGGAGGAAGGAAGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019840522 7:3438111-3438133 CTGGGGCAAAGGCAGGATGCAGG - Intronic
1019969141 7:4526131-4526153 CAGGGGAAGAGGAAGAAGAAAGG + Intergenic
1020050330 7:5077052-5077074 AGGAAGAAAAGGAAGGAGGAAGG - Intergenic
1020092659 7:5350121-5350143 ATGGGGGAAAGGGAGGAGGCCGG + Intronic
1020100841 7:5393605-5393627 CCTGGGAGGAGGAAGGAGGAAGG + Intronic
1020129043 7:5549150-5549172 AAGGGAAGAAGGAAGGAGGAAGG + Intronic
1020201922 7:6086675-6086697 AAGGGGAAAGGGAAGGGGGAAGG - Intergenic
1020688906 7:11330253-11330275 CTGGGGCAAATGAGAGAGGAGGG - Intergenic
1020842026 7:13230086-13230108 GAGGGAAAAAGGAAAGAGGAAGG - Intergenic
1020887719 7:13840066-13840088 GAGGAGAAAAGAAAGGAGGAAGG + Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021334313 7:19379885-19379907 ATAGGGAGATGGAAGGAGGAAGG - Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1022231963 7:28423078-28423100 CAGGAGAAAAGGAAGAAGGGAGG - Intronic
1022785714 7:33635032-33635054 CGGGGGAAAAGGAAGGACACTGG - Intergenic
1022809762 7:33857318-33857340 TTGAGGAAAAGGAAACAGGAGGG + Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1023338291 7:39192909-39192931 AAGGAGAAAAGGATGGAGGAAGG + Intronic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1023356422 7:39371540-39371562 CAGGGGTAAAGGATGGAGGGAGG - Intronic
1023478184 7:40603968-40603990 CTGGGGATAATGAAAGATGAAGG - Intronic
1023488336 7:40710954-40710976 CTGGGGTAAAGGAAGGAATTGGG + Intronic
1023613045 7:41990955-41990977 CTGGAAGAAAGGAAGGAGGCAGG + Intronic
1023822901 7:43989973-43989995 CTCAGGGAAAGGAAGGAGGCAGG + Intergenic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026040642 7:66865603-66865625 AAGGGGAAAAGGAAGGGGAAGGG - Intergenic
1026085698 7:67261268-67261290 CTGGCATATAGGAAGGAGGAAGG - Intergenic
1026361067 7:69600591-69600613 TTGGGAGAAAGGAGGGAGGAGGG + Intronic
1026557782 7:71422892-71422914 ATGGGGAGCAGGAAGGGGGATGG + Intronic
1026632402 7:72048781-72048803 AAGGAAAAAAGGAAGGAGGAAGG - Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026927560 7:74204521-74204543 AGGGGGGAAAGGAAGGAGGGAGG + Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027121406 7:75524844-75524866 CAGAGGAGAAGGAAGAAGGAGGG - Intergenic
1027229980 7:76267129-76267151 ATGGTGAAAAGGCAGGTGGAGGG + Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027958907 7:84918932-84918954 ATGGTGAAAAGCAAAGAGGAAGG + Intergenic
1028002581 7:85518706-85518728 TCGGGGAGAAGGAAGGAGGGAGG + Intergenic
1028097646 7:86782173-86782195 AGGGTGAAAGGGAAGGAGGAAGG - Intronic
1028285189 7:88987969-88987991 GAGAAGAAAAGGAAGGAGGAGGG - Intronic
1028382161 7:90211828-90211850 CAGGGGAGAAGGAAGGAGGGAGG - Exonic
1028473436 7:91228972-91228994 GTGGGGAAAAGTCAGCAGGAGGG + Intergenic
1028631488 7:92939431-92939453 CTGGTGAAATGGAAGCAGAATGG + Intergenic
1028832160 7:95340144-95340166 CTTAGGAAAAGAAAGGAAGAAGG - Intergenic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029293817 7:99523250-99523272 CTGGGGTACAGGAAGGAGGAAGG + Intronic
1029412834 7:100426826-100426848 GGGAGGAAAGGGAAGGAGGAGGG - Intronic
1029483953 7:100828008-100828030 TGGGGGAAAAGGAAGGAAAAGGG + Intronic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1029637363 7:101793944-101793966 CTGGGGAGCAGGGAGGAGGGAGG + Intergenic
1029751166 7:102543403-102543425 CTCAGGGAAAGGAAGGAGGCAGG + Intronic
1029769118 7:102642508-102642530 CTCAGGGAAAGGAAGGAGGCAGG + Intronic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1030011464 7:105172355-105172377 CAGGGGAGTAGGAAGGAAGAAGG + Intronic
1030087925 7:105832949-105832971 CTGGGGTAAAGGTAGAAGCACGG - Intronic
1030178455 7:106679117-106679139 TTGGGGAAAAGAAAGAAAGAGGG + Intergenic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030278615 7:107745682-107745704 TTGGTGAAAATGAAGGAGAATGG + Intronic
1030486801 7:110179074-110179096 AGAGGGAAAAGAAAGGAGGAAGG + Intergenic
1030656505 7:112173995-112174017 GTGGGGAAAGGCAATGAGGAAGG - Intronic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031376799 7:121036270-121036292 TTGGGGAAAAGGCTGGGGGATGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031693444 7:124818730-124818752 GTGGGGAACTGGAAGGGGGATGG - Intergenic
1031774685 7:125892775-125892797 CTGTGGAAAAAAAAGGAGTAGGG - Intergenic
1031969286 7:128052452-128052474 ATGGGGAAAAGGAGACAGGATGG - Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032306407 7:130736050-130736072 TTGGGGAAAAGGGTGGAGAATGG - Intergenic
1032455296 7:132068592-132068614 CTGGTGAGAAGGAAGGGGGTGGG - Intergenic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1033042013 7:137927430-137927452 GGAGGGGAAAGGAAGGAGGAAGG + Intronic
1033090692 7:138383065-138383087 TTTGGCAAAAGGAAGGAGGAAGG - Intergenic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033263659 7:139865830-139865852 AGGGGGGAAAGGAAGAAGGAAGG + Intronic
1033291724 7:140090882-140090904 GTGGGGGAGAGGAAGAAGGAGGG - Exonic
1033426297 7:141247584-141247606 GTAGGGAAAGGGAAAGAGGATGG + Intronic
1033589515 7:142797630-142797652 CTGGGGAAGAGGGAGGGGGTGGG + Intergenic
1033658882 7:143390555-143390577 CTGGGAAGAAGGAAGGGTGAGGG - Intronic
1033961083 7:146913900-146913922 CAGGGGAAAGGGTAGGAGGGTGG - Intronic
1034059347 7:148072142-148072164 CAGGGGTAAAGGTAGGAGGGAGG - Intronic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034391528 7:150791404-150791426 GTGGGGAGAAGAAAGGAGGAGGG + Exonic
1035283013 7:157788982-157789004 CTTGGGAAATGGAGGCAGGAAGG - Intronic
1035339591 7:158151682-158151704 TTGGGGAGAAGGAAGAAAGAAGG - Intronic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036487235 8:9190237-9190259 CTTGAGGAAAGGATGGAGGATGG - Intergenic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036920619 8:12851014-12851036 CTGGGGGAAAAGACGGAGGCTGG - Intergenic
1037116534 8:15236100-15236122 CTGGGCAAAGGGAAGTAGGGAGG - Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1038040730 8:23722239-23722261 GTGGGGGAGAGGGAGGAGGATGG + Intergenic
1038087691 8:24218029-24218051 GTGGAGAGATGGAAGGAGGAAGG + Intergenic
1038209564 8:25503464-25503486 CTCGGGAATAGGACTGAGGAGGG - Exonic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038426926 8:27469677-27469699 CTGGGGTAGAGGAAGGAGCAGGG + Intronic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039081617 8:33739359-33739381 GTGGGGAAAGGGAAGGAAGCAGG + Intergenic
1039261857 8:35780455-35780477 CCGAGGAAAAGGATGGAGGAAGG + Intronic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1040537178 8:48320625-48320647 AAGGGGAAAATAAAGGAGGAAGG + Intergenic
1040692735 8:49959252-49959274 CTGGTGAAAAGCAAGAAGGCAGG + Intronic
1040701321 8:50069698-50069720 CTGGGGAGAAGTCAGGAGGAAGG - Intronic
1041097173 8:54361598-54361620 AAGGAGAAAAGGAAGGAAGAAGG - Intergenic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041419220 8:57647733-57647755 CTGGAGAAATGGAAGATGGATGG - Intergenic
1041479461 8:58302651-58302673 ATGGGAAAAAGGAAGAGGGAAGG + Intergenic
1041512401 8:58666434-58666456 CTGAGGAGAAATAAGGAGGAAGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041686320 8:60648144-60648166 CTAGGGAACAGCATGGAGGAAGG - Intergenic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1042155122 8:65836896-65836918 AGGGGGAGGAGGAAGGAGGATGG - Intronic
1042461056 8:69069349-69069371 CTTGGGAAAAAGAAAGATGAAGG - Intergenic
1042621759 8:70714073-70714095 GTGGGGATGAGTAAGGAGGAGGG + Intronic
1043052080 8:75396739-75396761 GTGGTGAGAAGGAAAGAGGAGGG - Intergenic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1043944763 8:86237524-86237546 CTGAGGAAAAGGAAAGAGACAGG + Intronic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044364358 8:91325729-91325751 CAAGGGAAAAGGAAGCAGCAGGG + Intronic
1044531221 8:93309936-93309958 CATGGGAGAAGGAAGGAGGCAGG - Intergenic
1044591579 8:93917711-93917733 GGGGGGAAGAGGATGGAGGAGGG - Intronic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1044837754 8:96312833-96312855 CTGGGGCAGAGGAAGGAAGTGGG - Intronic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045322015 8:101089296-101089318 ATTGGGAGAAGGAAGGAGGATGG + Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045423894 8:102043737-102043759 ATGGGGAAAGGGAAGGGGAAGGG + Intronic
1045426786 8:102075008-102075030 CCAGGCAAAAGGAAGGAGGAAGG + Intronic
1045516441 8:102864269-102864291 CCGGAGAAAAGGGAGGGGGACGG + Exonic
1045837441 8:106538834-106538856 GTGGGGAAAAGGAAAAAGTATGG + Intronic
1046061445 8:109144670-109144692 CTGGACAAAGGGAAGGAGCAGGG - Intergenic
1046592696 8:116225146-116225168 CTGGGGCAAAGGAAGTGGGAAGG + Intergenic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1047450049 8:124957055-124957077 GGTGGGAAAAGGAAGGAGAAAGG - Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047833985 8:128667973-128667995 CTGGGGAGAAGGAAGGGGAGTGG - Intergenic
1047907191 8:129484740-129484762 CTGGGGAAAAGGGAAGGGCAGGG - Intergenic
1048070262 8:131013362-131013384 GTAGGGTAAGGGAAGGAGGAAGG + Intronic
1048148160 8:131865666-131865688 ATAGGGGAAAGCAAGGAGGAAGG - Intergenic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049311819 8:141937496-141937518 AACGGGAAAAGGAAGGAGAAAGG - Intergenic
1049353497 8:142176672-142176694 GTGGGGAAAAGGACGGGGGCAGG - Intergenic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049478835 8:142810453-142810475 GTGGAGGAAGGGAAGGAGGAAGG - Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050124526 9:2342920-2342942 CTGGGAAAAAGGTATGTGGATGG + Intergenic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050422803 9:5484406-5484428 CTAGGGAGAAGGAAGGATAAGGG - Intergenic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050598045 9:7223771-7223793 AGGGAGGAAAGGAAGGAGGAAGG - Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1050874346 9:10615412-10615434 GTGGGGAGGAGGTAGGAGGAAGG - Intergenic
1051190044 9:14501807-14501829 GGGGAGAGAAGGAAGGAGGAAGG - Intergenic
1051250398 9:15153013-15153035 GTGGGGAAAGGGAAAAAGGAGGG - Intergenic
1051325575 9:15963984-15964006 CTAGCGAGAAGAAAGGAGGATGG - Intronic
1051475744 9:17507130-17507152 GTGGGGAAAAGGAGGGAGAGAGG - Intergenic
1051712382 9:19945302-19945324 GAGGGGAAAAGGAAGGAGGGAGG + Intergenic
1051749358 9:20325351-20325373 CAGGAGAAAAGGAAGGAGTGAGG + Intergenic
1052072331 9:24096868-24096890 CTTGGGAAGAGGTGGGAGGATGG + Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052609210 9:30748653-30748675 CTGGGGAAAAGGGTGGTGGTAGG + Intergenic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053376346 9:37609828-37609850 CTGAGGAAGAGCAAGGAGGCTGG - Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053508028 9:38661514-38661536 AGGGAGAAAAGGAAGGATGAAGG + Intergenic
1053751144 9:41256801-41256823 CGGGGGCAGAGGCAGGAGGATGG + Intergenic
1054256664 9:62821130-62821152 CGGGGGCAGAGGCAGGAGGATGG + Intergenic
1054334646 9:63794482-63794504 CGGGGGCAGAGGCAGGAGGATGG - Intergenic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055106983 9:72523225-72523247 GTGGGGAAAATGAAGGAGAAGGG + Intronic
1055142345 9:72889850-72889872 CTGCAGAAAAGTAAGAAGGAAGG - Intergenic
1055177336 9:73336259-73336281 AGGGGGAAAAGGAAGGAAGATGG - Intergenic
1055320374 9:75078072-75078094 CTGGGAAAGATGAAGGAGAAAGG + Intronic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055723135 9:79197979-79198001 AAGGGGAAAAGAAAGGAGGTAGG - Intergenic
1055819321 9:80242814-80242836 ATGGAGAGAAGGAAGGAGGTAGG - Intergenic
1055877253 9:80958401-80958423 AGAGGGAAAAGGACGGAGGAAGG - Intergenic
1056037049 9:82617912-82617934 TTGGCGTCAAGGAAGGAGGAAGG + Intergenic
1056073999 9:83019913-83019935 AAGGGGCAAAGAAAGGAGGAAGG + Intronic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1056178927 9:84062663-84062685 CTGGGAAAAAGGAGGCAGGCAGG + Intergenic
1056344144 9:85673232-85673254 AGGGGGATAGGGAAGGAGGATGG + Intronic
1056406881 9:86283090-86283112 CTGGGGAGAAGGGTGGAGGGTGG - Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056655174 9:88503076-88503098 CTGGGGAGAAGGATGGAGCTGGG + Intergenic
1056824951 9:89870584-89870606 CTGGAGAAAAGGAATCAGGCTGG - Intergenic
1056998444 9:91485466-91485488 CTGAGGAGAAGGAAGGAGTATGG - Intergenic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057077642 9:92147287-92147309 AGGGAGAGAAGGAAGGAGGAAGG - Intergenic
1057191371 9:93089754-93089776 CTGGGGGCAGGGAAGGAGGGAGG - Intergenic
1057298783 9:93864709-93864731 GGGTAGAAAAGGAAGGAGGAGGG - Intergenic
1057527099 9:95812508-95812530 CTGGGAAAAAGAAAAGAGGATGG - Intergenic
1057825911 9:98371931-98371953 CTGGGCAGCAGGAAGAAGGAAGG - Intronic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058033908 9:100230056-100230078 CTGGGGTACAGGAATGAGCACGG - Intronic
1058136524 9:101313820-101313842 CTGGGGATAAGGGAAAAGGAAGG - Intronic
1058268952 9:102944981-102945003 CTTAAGAAAAGGAAGGAGGTGGG - Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058793198 9:108471536-108471558 CTGAGGCTAAGGCAGGAGGATGG + Intergenic
1058902806 9:109456880-109456902 GGAAGGAAAAGGAAGGAGGATGG - Intronic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1059111170 9:111559558-111559580 CTGGTGAGCAGGAAGAAGGAGGG - Intronic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059209756 9:112502089-112502111 CTGGTGAGTAGAAAGGAGGAGGG + Intronic
1059392409 9:114007518-114007540 CTGGGTAAGAGGGAGGAGGGAGG - Intronic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1059718678 9:116937294-116937316 CAGGGAATAAGGAAGGAGGTGGG - Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1059838206 9:118181222-118181244 GTGGGGAAGAGGAGGGAGAAAGG - Intergenic
1059970122 9:119658635-119658657 GTATGGAGAAGGAAGGAGGATGG + Intergenic
1060290716 9:122300056-122300078 GTGGAGAAAGGGAAGGAAGAGGG + Intronic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060367517 9:123033564-123033586 CTTGGGAAAAGGAAGAAAGGGGG - Intronic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060698618 9:125731392-125731414 GAGAGGAAAAGGAAGCAGGAGGG - Intergenic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061805879 9:133137617-133137639 CGGGGGAAGAGCGAGGAGGAAGG + Intronic
1061923617 9:133795382-133795404 CTGGGGGAAAAGCAGGGGGAGGG + Intronic
1062097958 9:134712417-134712439 AGGGGGAACAGGAAGGAGTAGGG - Intronic
1062097981 9:134712495-134712517 AAGGGGGACAGGAAGGAGGAGGG - Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062164555 9:135100984-135101006 CCTGGGAAGAGGGAGGAGGAAGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062314580 9:135960516-135960538 AAGGGGAAGAGGAAGGAGAAGGG + Intronic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062453000 9:136623348-136623370 CTGGAGAGAAGGAAGGAGAAAGG - Intergenic
1062588676 9:137263357-137263379 CGGGGGAGAAGGGAGAAGGAGGG - Intronic
1203467798 Un_GL000220v1:104116-104138 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203475623 Un_GL000220v1:148092-148114 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203660178 Un_KI270753v1:34111-34133 CTGGGAAAAAGGAAAGACAAAGG + Intergenic
1203670946 Un_KI270755v1:11073-11095 CTGGGAAAAAGGAAAGACAAAGG + Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1185735848 X:2495652-2495674 CAAGGGAGGAGGAAGGAGGAAGG - Intronic
1185766832 X:2732479-2732501 GAGGGGGAAAGAAAGGAGGAGGG - Intronic
1185827033 X:3261343-3261365 CTGCAGACCAGGAAGGAGGAAGG + Intergenic
1185834040 X:3328859-3328881 CAGGAGAGAAGGCAGGAGGAAGG + Intronic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186206328 X:7204657-7204679 GAGGAAAAAAGGAAGGAGGAAGG - Intergenic
1186356803 X:8799600-8799622 ATGGGGGAAGGGGAGGAGGAGGG - Intronic
1186357130 X:8800715-8800737 ATGGGGGAAGGGGAGGAGGAGGG - Intronic
1186561568 X:10618918-10618940 ATGAGGAAAAGGAAGGAGAAGGG - Intronic
1186927943 X:14355915-14355937 TTGGGGAAAAGAAAGTATGAAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1187479899 X:19645861-19645883 CTGGAAAAATGGAAGTAGGAGGG + Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1187997634 X:24945933-24945955 CTAGGGAAAAGTAAGCAAGAAGG + Intronic
1188013001 X:25077233-25077255 CCTGGGGACAGGAAGGAGGATGG - Intergenic
1188705685 X:33326768-33326790 CTGGAGAGAAGCAAGAAGGAAGG + Intronic
1188755087 X:33952570-33952592 TTGGTGAAAATGAAGGGGGAGGG + Intergenic
1188965394 X:36545352-36545374 CTGGGGAAAATGAAAGTGTAGGG - Intergenic
1189110596 X:38286083-38286105 AGGGGGAAGAGGAAGGAGAAGGG - Exonic
1189242005 X:39532565-39532587 TGGGGGAGAAGGGAGGAGGAAGG + Intergenic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189514942 X:41704028-41704050 TAGGGGAAAAGGGAGGGGGAGGG - Intronic
1189935363 X:46062506-46062528 CTGGGGAGCAGGAATGGGGAAGG - Intergenic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190071315 X:47282179-47282201 AAGGGAGAAAGGAAGGAGGAAGG - Intergenic
1190217558 X:48490050-48490072 CTGAGGAAAAGGAGGGAGCCGGG + Intergenic
1190534175 X:51409101-51409123 CTGGAGAAAAGGAGGGGTGATGG + Intergenic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190633345 X:52410974-52410996 CTGGGAAACAGGGAGGTGGATGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191091389 X:56626274-56626296 GTGGGGAGAAGAAAAGAGGAGGG + Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192264403 X:69529179-69529201 CTGGGGAAGAGGGAGGAGGCCGG + Intronic
1193252209 X:79304724-79304746 ATGGGGAAAAGGAAGGCTTAAGG - Intergenic
1193456699 X:81740134-81740156 CTGGGGGAAAGGAAGGAAGGAGG - Intergenic
1193956709 X:87872732-87872754 CAGGGCAAAAGAAAGGAGAAAGG - Intergenic
1195696219 X:107669582-107669604 TGGGGGAGGAGGAAGGAGGAAGG - Intergenic
1195712711 X:107786982-107787004 AGGGAGAGAAGGAAGGAGGAAGG + Intronic
1195809702 X:108816222-108816244 TTGGGGAAAAGGTATGTGGATGG - Intergenic
1195923547 X:110003955-110003977 CTGAGGCAGACGAAGGAGGACGG + Exonic
1195934630 X:110113051-110113073 TGGCGGAAAAGGAAGGAGGAAGG - Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196492241 X:116281347-116281369 TTAGGGAAATGCAAGGAGGAGGG - Intergenic
1196511133 X:116513930-116513952 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1196657333 X:118232206-118232228 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1196761744 X:119207070-119207092 ATGGGGTAAAGGAATGTGGATGG + Intergenic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1197393663 X:125898769-125898791 CTGGGGAAAGGAAAAGAGAAAGG - Intergenic
1197545774 X:127822189-127822211 CAGGGGAAAGGGAGGGAGTAGGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198018807 X:132638185-132638207 CTGGGTCAAAGCAAGGAGGAAGG + Intronic
1198112062 X:133510366-133510388 AGGGAGAAAAGGAGGGAGGAAGG - Intergenic
1198273545 X:135079081-135079103 CTAGGGAAAAAAAAGGAGGAGGG - Intergenic
1198321584 X:135522370-135522392 CAGGAGAAAAGTAGGGAGGACGG + Intronic
1198735151 X:139776576-139776598 CTTGGGGAAAGGAACAAGGAGGG - Intronic
1198791629 X:140353128-140353150 GTAGGGAAAAGGAAGGGGGATGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199413798 X:147556598-147556620 CTCGAGAAAAGGTAAGAGGAAGG + Intergenic
1199555057 X:149098138-149098160 AAGGAGAGAAGGAAGGAGGAAGG + Intergenic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199825742 X:151497922-151497944 TTGGGGAAGAGGATGGGGGAGGG - Intergenic
1199895915 X:152127753-152127775 TTGGGGAAGAGAATGGAGGAGGG - Intergenic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199955681 X:152740551-152740573 TTGGGGAAGAGGATGGAGAAGGG - Intergenic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200222912 X:154400645-154400667 CTGGGGCAAAGGTGGGAGAAGGG - Intronic
1200224356 X:154409076-154409098 CTGGGGAGACGGAAGAAGGGAGG - Intronic
1200316665 X:155139980-155140002 GTGGGGAAAAGCATGGGGGAAGG + Intronic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic