ID: 1073318415

View in Genome Browser
Species Human (GRCh38)
Location 10:102599150-102599172
Sequence CACAGGAAAGAAAAGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073318408_1073318415 7 Left 1073318408 10:102599120-102599142 CCATGTTAAGGGTAAACCTCGGG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG No data
1073318411_1073318415 -9 Left 1073318411 10:102599136-102599158 CCTCGGGCCTGTGACACAGGAAA 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073318415 Original CRISPR CACAGGAAAGAAAAGGATGG TGG Intronic
No off target data available for this crispr