ID: 1073322890

View in Genome Browser
Species Human (GRCh38)
Location 10:102626289-102626311
Sequence ATGGCCCAGCAGATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073322877_1073322890 22 Left 1073322877 10:102626244-102626266 CCTGGCTCTGCCTAGCAGCCTGA 0: 1
1: 0
2: 2
3: 18
4: 292
Right 1073322890 10:102626289-102626311 ATGGCCCAGCAGATTGAGGAAGG No data
1073322881_1073322890 12 Left 1073322881 10:102626254-102626276 CCTAGCAGCCTGACGAGAGGGGT 0: 1
1: 0
2: 1
3: 13
4: 104
Right 1073322890 10:102626289-102626311 ATGGCCCAGCAGATTGAGGAAGG No data
1073322886_1073322890 4 Left 1073322886 10:102626262-102626284 CCTGACGAGAGGGGTGGGTGGGG 0: 1
1: 0
2: 1
3: 28
4: 245
Right 1073322890 10:102626289-102626311 ATGGCCCAGCAGATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073322890 Original CRISPR ATGGCCCAGCAGATTGAGGA AGG Intronic
No off target data available for this crispr