ID: 1073323908

View in Genome Browser
Species Human (GRCh38)
Location 10:102631638-102631660
Sequence GCACCCTGTGGGCACTCCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073323908_1073323916 23 Left 1073323908 10:102631638-102631660 CCACAGGAGTGCCCACAGGGTGC 0: 1
1: 0
2: 3
3: 22
4: 204
Right 1073323916 10:102631684-102631706 AGCCAAAGAGCTGCCCCCAGGGG 0: 1
1: 1
2: 0
3: 22
4: 186
1073323908_1073323918 30 Left 1073323908 10:102631638-102631660 CCACAGGAGTGCCCACAGGGTGC 0: 1
1: 0
2: 3
3: 22
4: 204
Right 1073323918 10:102631691-102631713 GAGCTGCCCCCAGGGGTATGAGG 0: 1
1: 0
2: 2
3: 20
4: 238
1073323908_1073323915 22 Left 1073323908 10:102631638-102631660 CCACAGGAGTGCCCACAGGGTGC 0: 1
1: 0
2: 3
3: 22
4: 204
Right 1073323915 10:102631683-102631705 CAGCCAAAGAGCTGCCCCCAGGG 0: 1
1: 0
2: 0
3: 26
4: 255
1073323908_1073323914 21 Left 1073323908 10:102631638-102631660 CCACAGGAGTGCCCACAGGGTGC 0: 1
1: 0
2: 3
3: 22
4: 204
Right 1073323914 10:102631682-102631704 CCAGCCAAAGAGCTGCCCCCAGG 0: 1
1: 0
2: 3
3: 18
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073323908 Original CRISPR GCACCCTGTGGGCACTCCTG TGG (reversed) Exonic
902381620 1:16055517-16055539 ACACCAGGTGGGTACTCCTGAGG + Exonic
903785917 1:25861383-25861405 GCACCCTGTGTCCACTCCCAGGG + Exonic
904963641 1:34354790-34354812 GCTCCCTGTGGGAACTGCTGAGG + Intergenic
906328165 1:44861757-44861779 GAAAGCTGTGGGCTCTCCTGAGG + Intronic
909658121 1:78053435-78053457 GCACTCTATGGGAAATCCTGGGG - Intronic
910229743 1:84973942-84973964 GCACCAGGTGGCCACTGCTGGGG - Intronic
910558417 1:88563067-88563089 GAAACCTGTGGGGACTCCTGAGG - Intergenic
911672980 1:100628297-100628319 TCACCCTGTGGTAACTACTGGGG + Intergenic
912475877 1:109934440-109934462 TCAACCTGTGGGCTTTCCTGTGG - Intergenic
915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG + Intronic
915839033 1:159200953-159200975 GGGCCCTGTGGGGACTGCTGGGG + Exonic
917489143 1:175482914-175482936 TCACCTGGTGGGCGCTCCTGGGG + Intronic
919370110 1:196712777-196712799 TCACACTGTGGGGACTGCTGTGG - Intronic
922768547 1:228169144-228169166 GCCCCCTCTGGTCACTCCTCTGG + Intronic
922882101 1:228988864-228988886 GCTCCCTGTGAGCATGCCTGTGG - Intergenic
923099556 1:230801487-230801509 GCAAACTGGGGCCACTCCTGAGG + Intronic
1062925050 10:1309903-1309925 GCCACCTGCGGGCACACCTGGGG + Intronic
1063209067 10:3862277-3862299 GCACCCTTTTGTCACTTCTGAGG + Intergenic
1065046736 10:21752590-21752612 GCACCACATGGGCCCTCCTGGGG + Intergenic
1065188650 10:23192145-23192167 GCTCCCTTTGGGAGCTCCTGGGG - Intergenic
1066653489 10:37680366-37680388 GCGGCCTGAGGGCACTGCTGAGG + Intergenic
1067061748 10:43081345-43081367 GCAGGCTGGGAGCACTCCTGAGG + Intronic
1067428849 10:46228801-46228823 CCACCCTGAAGCCACTCCTGCGG + Intergenic
1067718064 10:48704664-48704686 GCTGCCTGTGTGCACTGCTGGGG + Intronic
1067748657 10:48955844-48955866 GCACAGAGTGGGCACTGCTGTGG + Intronic
1068519745 10:58065114-58065136 GGAACCTGTGGGCACAGCTGAGG - Intergenic
1069688596 10:70335015-70335037 GCACCCTGTGGGCTCACCCTGGG + Intronic
1070614419 10:77958537-77958559 GTAGCCTCTGGCCACTCCTGGGG + Intergenic
1071880918 10:89897581-89897603 GAACCTGGAGGGCACTCCTGTGG + Intergenic
1073139768 10:101239352-101239374 GCACCCTGTCTGCTCGCCTGGGG - Intergenic
1073323908 10:102631638-102631660 GCACCCTGTGGGCACTCCTGTGG - Exonic
1076005341 10:126944295-126944317 GCACCCTGTGCCCAGTGCTGGGG - Intronic
1076090891 10:127684580-127684602 GAGCCCTGTGGGCTTTCCTGTGG - Intergenic
1076497608 10:130907216-130907238 GCAGCCTGCAGGCCCTCCTGGGG + Intergenic
1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG + Intronic
1077114013 11:874983-875005 GAGCCCTGTGGGGGCTCCTGAGG - Intronic
1077187862 11:1243489-1243511 GCACCGTGTGGGGACTGCTGGGG - Exonic
1077188283 11:1245160-1245182 GCACCGTGTGGGGACTGCTGGGG - Exonic
1077188818 11:1247260-1247282 GCACCGTGTGGGGACTGCTGGGG - Exonic
1077189237 11:1248931-1248953 GCACCGTGTGGGGACTGCTGGGG - Exonic
1077292211 11:1803077-1803099 GCACCCTGTGGGTGATGCTGGGG + Intergenic
1077458034 11:2692634-2692656 GCACCCTGAGGGGAGTGCTGAGG - Intronic
1078492413 11:11781701-11781723 GCATCCAGTGGGCACTCATTGGG - Intergenic
1079335189 11:19564705-19564727 GCACACGGTGGGCACTCAAGCGG - Intronic
1081867891 11:46369616-46369638 GCCCCCTGGTGGCACTCCAGAGG - Intronic
1083295866 11:61715420-61715442 GTTCCCTGTGGACACTCCAGAGG + Intronic
1083378587 11:62245701-62245723 GCTCCCTCTGGGGACTCTTGGGG + Intergenic
1084226077 11:67715563-67715585 GCTTCCTGTGGACACTCCGGGGG - Intergenic
1084263908 11:67995437-67995459 GCTTCCTGTGGACACTCCGGGGG - Intronic
1085981740 11:81733864-81733886 GCACCATGTAGCCACTGCTGGGG + Intergenic
1088913995 11:114213059-114213081 GCCCCCTGTGGGCACACAGGGGG - Intronic
1091372169 11:135070141-135070163 GCACCGTGTTCGCATTCCTGAGG - Intergenic
1095943543 12:47740995-47741017 GCCCACTGTGGGCTCTGCTGAGG - Exonic
1096790045 12:54038905-54038927 GCACCCTGGGGTCAATCCTCAGG + Intronic
1096792109 12:54051808-54051830 GCACCCTTTGGGCACGGCTGTGG + Intronic
1098150038 12:67537408-67537430 GCACCCTCTGTGCACTCTTCAGG + Intergenic
1103680511 12:122690145-122690167 GCACCTTCTGGGGCCTCCTGTGG + Intergenic
1104589641 12:130074130-130074152 GAGCCCTATGGGCACTGCTGAGG + Intergenic
1107204986 13:37773552-37773574 GCACCATGTGGGTACTGCTAAGG - Intronic
1107559447 13:41546489-41546511 GCAGGCTTTGGGCATTCCTGGGG + Intergenic
1115047653 14:29016426-29016448 GCTCCCTGTTGGCAATCCAGGGG - Intergenic
1115074156 14:29365336-29365358 TCACCCTCTGGGCACTCTTAAGG - Intergenic
1118315196 14:64721787-64721809 GCACCCTAGGGGCTCTCCTGGGG - Intronic
1118738095 14:68716854-68716876 GCTCCCTGCGGGCTCTCCTAGGG - Intronic
1118920953 14:70149595-70149617 GCAGCCTGTAGGCAGTACTGAGG - Intronic
1119323681 14:73746194-73746216 ACACCCTGTGGGCATTTGTGGGG - Intronic
1122194766 14:100076713-100076735 GCACTCTGTGGCCTCTGCTGTGG - Intronic
1122408454 14:101514006-101514028 GCACCCTGTGCCCCATCCTGTGG - Intergenic
1122461678 14:101900931-101900953 GCTCTCTGTGCGCACACCTGTGG - Intronic
1122865869 14:104603737-104603759 GCACCCTGGGGGCCCTCTGGGGG - Intronic
1124361000 15:29036412-29036434 GCACCCTGTGGCTACTAGTGAGG - Intronic
1125533487 15:40429000-40429022 ACTCCCTATGGCCACTCCTGTGG + Intronic
1126165370 15:45650298-45650320 TCACCCTGTGGACCCTCGTGGGG + Intronic
1127211720 15:56780461-56780483 GCAACCTGTGGGGCCACCTGTGG + Intronic
1132102307 15:99033026-99033048 GCCCCCTGTGGCTGCTCCTGAGG - Intergenic
1132600169 16:769611-769633 GCAGCCTGTGGGCCCCCCTGGGG - Exonic
1132628295 16:902902-902924 GCATCCTGTGGGCAGTGCAGAGG - Intronic
1132643928 16:990214-990236 GCACCTGGGGGGCACTGCTGGGG - Intergenic
1133102832 16:3489580-3489602 GCTCACTGTGGGCAGCCCTGTGG - Intergenic
1133728433 16:8558301-8558323 GCACCCTCTGAGGACTCCAGTGG + Intergenic
1133820039 16:9227821-9227843 GCACCATGTGGCCACTGCTGGGG - Intergenic
1138521525 16:57574218-57574240 GCCCTCAGTGGGCTCTCCTGCGG + Intronic
1139941737 16:70610536-70610558 AGACCCTGTGGTCATTCCTGTGG + Intronic
1140519428 16:75568566-75568588 GGAGCCTGTGGGCCCTGCTGAGG + Intronic
1142170388 16:88618938-88618960 GCACTCGGTGGGCTGTCCTGGGG + Intronic
1142919131 17:3169298-3169320 GCACCATGTAGCCACTGCTGGGG - Intergenic
1145306998 17:21680915-21680937 GCACCATCTGGGCAGGCCTGAGG + Intergenic
1145307911 17:21685575-21685597 GCACCGTCTGGGCAGGCCTGAGG + Intergenic
1145971586 17:28959537-28959559 GCAATTTGTGGGCACTCCTGCGG - Intronic
1147625558 17:41897561-41897583 CTTCCCTGTGGGCGCTCCTGAGG - Intronic
1149534300 17:57420614-57420636 GCACCCCGTGGGCCCTTCTTGGG + Intronic
1151599760 17:75099002-75099024 GCAGCCTGAGGGCCCGCCTGAGG + Intronic
1152407259 17:80104810-80104832 GCACTGTGTGGGCACTGCTCTGG - Intergenic
1152562099 17:81083680-81083702 GCACTCTGGGGGCGCTTCTGGGG + Intronic
1152639412 17:81443449-81443471 GCCCCCTGTGGGCATTGCAGTGG + Exonic
1152644169 17:81461191-81461213 GCAGCTTGTGGGCTCCCCTGGGG - Exonic
1153164253 18:2243958-2243980 GAAGGCTGTGGGCACTGCTGAGG - Intergenic
1153838712 18:8987306-8987328 GCACCGAGGGGGCACTCCTAGGG - Intergenic
1160386260 18:78498772-78498794 GCACCGTCTCGGCACTGCTGGGG - Intergenic
1161333629 19:3699783-3699805 GCACCCTGTGTGCACAGCCGGGG + Intronic
1161511568 19:4675114-4675136 GCCATCTGTGGGGACTCCTGGGG - Intergenic
1161570883 19:5030401-5030423 TCACCCTGTGGCCAGTCCTGTGG + Intronic
1161606317 19:5216738-5216760 GCTCCCTGAGGGGGCTCCTGAGG + Exonic
1164078240 19:21840200-21840222 CCCCCCTGTGGGCAGTGCTGAGG + Intronic
1164314377 19:24074018-24074040 CCTCCCTGTGGGCAGTGCTGAGG - Intronic
1164811234 19:31157929-31157951 TCACCCTGTGGTCACTCTCGTGG + Intergenic
1166071126 19:40388693-40388715 GCACCCTGAGGGCAAGGCTGGGG - Intronic
1166295339 19:41886689-41886711 CCACCCTGTGGGTCCACCTGGGG - Intronic
1167064754 19:47176549-47176571 GGACCCTGTGGGGACTCCAGTGG - Intronic
1167660693 19:50794464-50794486 GCACCCTGCTGGCCCTCCAGGGG + Exonic
1168124894 19:54277740-54277762 GGACCCTGTGGCCCCTCCTCTGG + Intronic
1168177092 19:54633809-54633831 GGACCCTGTGGCCCCTCCTCTGG - Intronic
925398321 2:3552924-3552946 GCACCCTCTGAGCCCTCCTAGGG - Intronic
925746170 2:7045526-7045548 TCTCCCTGTGTGCACGCCTGTGG + Intronic
928923744 2:36554738-36554760 GCACCCTGTGTATACTACTGAGG + Intronic
929589161 2:43134042-43134064 ACACCATGTGGCCAGTCCTGGGG - Intergenic
930591796 2:53336359-53336381 GCACCCAGTGTGCAATCCAGTGG + Intergenic
932698319 2:73975642-73975664 GCTTCCTGTGGGCACTCCTGGGG - Intergenic
934966384 2:98727568-98727590 GCATCCTGTGGCACCTCCTGAGG - Intronic
935321494 2:101893842-101893864 GCACCCGGTGGGCACTCTGGTGG + Intronic
946842890 2:223836168-223836190 GCACCCTGTGGGCCCACCGGAGG - Intronic
946941474 2:224774236-224774258 GCACCCAGTGGGGGCTCCTAAGG - Intronic
947719923 2:232364015-232364037 GGAGCCTGTGGGCTCTCCTGAGG - Intergenic
948814735 2:240504095-240504117 TCTTCCTCTGGGCACTCCTGTGG - Intronic
1169198748 20:3697434-3697456 CAACCCTGTGGGCACCCCAGGGG - Intronic
1173645555 20:44631206-44631228 GTACCCTCTGGGCACTCATGGGG - Intronic
1175232858 20:57485085-57485107 ACAGCCCGTGGTCACTCCTGGGG + Intergenic
1176032028 20:63017335-63017357 GCCCACTGAGGGCTCTCCTGAGG - Intergenic
1176388496 21:6151495-6151517 CCTCCATGGGGGCACTCCTGGGG + Intergenic
1176408233 21:6433488-6433510 CCACCCTGTGTGGACTGCTGAGG + Intergenic
1176876502 21:14135453-14135475 GCACCATGCCGCCACTCCTGGGG - Intronic
1177678843 21:24337832-24337854 TCACCAGGTGGCCACTCCTGTGG + Intergenic
1178722492 21:35022359-35022381 ACACCCTTCAGGCACTCCTGCGG - Intronic
1178912780 21:36689486-36689508 GCACACTGTGGCCACTCCGTGGG + Intergenic
1179683724 21:43041814-43041836 CCACCCTGTGTGGACTGCTGAGG + Intergenic
1179734976 21:43386753-43386775 CCTCCATGGGGGCACTCCTGGGG - Intergenic
1179930733 21:44569323-44569345 ACACCCTGTGTGCACACTTGCGG - Intronic
1179959059 21:44758235-44758257 GCTGCCTGTGGCCACTCATGCGG - Intergenic
1179968302 21:44818960-44818982 GCACCACCCGGGCACTCCTGAGG - Intergenic
1180593393 22:16958812-16958834 TTACCCTGTGAGCACACCTGGGG - Intergenic
1183282455 22:36939003-36939025 GCACCAGGTGGGCACCCGTGGGG + Exonic
1183737840 22:39653695-39653717 GCACCCTGTGACCAGGCCTGAGG - Intronic
1183933760 22:41250241-41250263 GCTCCCTGAGGGCCCGCCTGTGG - Intronic
1184098253 22:42328313-42328335 GCATCCTGTGGGCTCCCCTGAGG + Intronic
1184554775 22:45227214-45227236 GCACCTTCTGGGCCCTTCTGCGG + Intronic
1185097521 22:48819517-48819539 GGACCATGTGGGCACGCCTCGGG - Intronic
1185272794 22:49936407-49936429 GCGCCCTGTGGGCGGGCCTGGGG - Intergenic
1185411086 22:50683535-50683557 ACCTCCTGTGGGCAGTCCTGGGG - Intergenic
954443875 3:50536259-50536281 TGACCCTGTGGGCTCTGCTGGGG - Intergenic
954642620 3:52110614-52110636 GGCCTCTGTGGGCTCTCCTGTGG + Intronic
954647413 3:52140121-52140143 GCACCCTGTGGGCCTTGTTGAGG - Intronic
956284408 3:67593653-67593675 TCACCCTGTGGACTGTCCTGTGG - Intronic
957049318 3:75399051-75399073 GCACAGTGTGGGGACTGCTGGGG - Intergenic
957241916 3:77670903-77670925 GTATCCTCTGGGCCCTCCTGGGG - Intergenic
958655235 3:96993028-96993050 GCAGCCTGTTGGTGCTCCTGTGG + Intronic
959477524 3:106829336-106829358 GCATCCTGTGGATAATCCTGAGG - Intergenic
960938560 3:122918719-122918741 GCAGCCTGAGGGGACCCCTGAGG + Intronic
961035341 3:123637981-123638003 GCAGCCTGGGGACCCTCCTGTGG + Intronic
962267761 3:133955610-133955632 GCACCCTGTGCTCAGCCCTGGGG + Intronic
965789224 3:172369753-172369775 GCATCATGTGGGGACACCTGAGG - Intronic
966715569 3:183010328-183010350 GCACCCTGGGGTCAGCCCTGAGG + Intergenic
968480792 4:832238-832260 CCACACTGTGGGCACTCCTTGGG - Intergenic
968595614 4:1480907-1480929 CCACCCTGTGGCCAGCCCTGGGG - Intergenic
968690316 4:1986775-1986797 GTCCCCTGAGGACACTCCTGAGG + Intronic
969022428 4:4147345-4147367 GCTTCCTGTGGACACTCCGGGGG - Intergenic
969791050 4:9494155-9494177 GCTTCCTGTGGACACTCCAGGGG + Intergenic
970993309 4:22237342-22237364 GCCCCCTGTGGGCATGCATGTGG - Intergenic
974780032 4:66543144-66543166 GCACCATGTTGACACTGCTGGGG - Intergenic
975447354 4:74481328-74481350 CCTTCCTGAGGGCACTCCTGAGG + Intergenic
976087154 4:81418244-81418266 GGACCGTGTGGGCACCCTTGTGG - Intergenic
976423837 4:84877227-84877249 GCACCCTGAGCCCTCTCCTGGGG + Intronic
976544808 4:86322551-86322573 GTACCTTGGAGGCACTCCTGTGG + Intronic
980283455 4:130752766-130752788 GCATCCTCTGGACTCTCCTGGGG - Intergenic
985223359 4:187731815-187731837 TCACTCTATGGGCACTCCTATGG + Intergenic
992034854 5:72762960-72762982 GCACCCTGTGGCCAGTCAAGTGG + Intergenic
992426942 5:76667587-76667609 GAACCCTGTGGGCTCTGATGAGG - Intronic
993122519 5:83793771-83793793 TCACCCTCTGGGGACTACTGTGG - Intergenic
993520068 5:88889520-88889542 GCAGGCTCTGGGCCCTCCTGGGG + Intronic
997639960 5:135442624-135442646 CCACCCTGCAGGGACTCCTGAGG - Intergenic
998128895 5:139641224-139641246 TCTCCCTCTGTGCACTCCTGGGG - Intergenic
998480748 5:142460642-142460664 GCCCCCAGTGGGCACTCTTTAGG + Intergenic
999723620 5:154417176-154417198 GCTCCCTGTGGGGCCTCTTGTGG - Exonic
1001286514 5:170427680-170427702 GCAGCCTGGGAGCAGTCCTGGGG - Intronic
1002167485 5:177357562-177357584 CCACCCTGGGGGCGTTCCTGTGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002593418 5:180306496-180306518 CCACCCTCTGGGCAGCCCTGTGG + Intronic
1002643511 5:180641593-180641615 GCACCCTCTCTTCACTCCTGGGG + Intronic
1004353670 6:14912775-14912797 GGAACCTGTGGGCATTCCAGAGG - Intergenic
1007289613 6:40775526-40775548 GCAGCCTGTGAGCACTCCTGGGG + Intergenic
1010830471 6:80522191-80522213 GCAACCTGTGGGGTCTGCTGAGG + Intergenic
1017020599 6:150137030-150137052 TCACCCTCTGGGCACTCTGGAGG + Intergenic
1018456774 6:163960463-163960485 GCACCTTGTGGGGCCACCTGGGG + Intergenic
1019322432 7:421807-421829 GCCCCCTTTGAGCCCTCCTGAGG + Intergenic
1020447794 7:8287031-8287053 GCACCCTGTGGGGAGACCAGTGG + Intergenic
1023352323 7:39333060-39333082 GCACCCCCTGGGAACTCATGGGG + Intronic
1032255967 7:130297416-130297438 GCACCCTGTGGGCACTGCCGAGG - Intronic
1032549525 7:132771587-132771609 GCACCCTGGTGGCCCACCTGGGG + Intergenic
1032738322 7:134713191-134713213 ACACCCTGTGGACACCCCTTTGG + Intergenic
1033800295 7:144893131-144893153 TCTCCCTGGGGGTACTCCTGTGG - Intergenic
1034466710 7:151234022-151234044 GCTCCCTGTTGGCTCTGCTGCGG + Exonic
1035317984 7:158009107-158009129 GCACCAGGTGGGGCCTCCTGGGG - Intronic
1035365795 7:158348887-158348909 GGTCCCTGAGGGCACTGCTGAGG + Intronic
1035365929 7:158349338-158349360 GGTCCCTGAGGGCACTGCTGAGG + Intronic
1035574762 8:697448-697470 GCACCCTGGCAGCACCCCTGAGG - Intronic
1037832940 8:22199728-22199750 GCACCCTATGAGCCATCCTGGGG - Intronic
1039789766 8:40865966-40865988 GCACACAGAGGGCACTCCTGGGG - Intronic
1042486464 8:69351542-69351564 TCACACTGTGGGGACTGCTGTGG - Intergenic
1045687064 8:104723116-104723138 GCACCCTGTGCAGTCTCCTGGGG + Intronic
1049001814 8:139831090-139831112 GCTCCCTGTGGGCACTCAGTGGG + Intronic
1049221095 8:141429304-141429326 CCAGCCTGTGGCCACGCCTGAGG + Intronic
1049408084 8:142460555-142460577 GGCCCCTGTGGTCCCTCCTGTGG + Intronic
1049709418 8:144056931-144056953 GCACCCTGGGAGCCCACCTGGGG + Exonic
1049714292 8:144082661-144082683 GCAGCCTGTGGGCACCGCGGCGG + Exonic
1050703403 9:8366729-8366751 GCCACTTGAGGGCACTCCTGGGG + Intronic
1056208297 9:84340901-84340923 GCATCCTATTTGCACTCCTGGGG + Intergenic
1056697450 9:88871944-88871966 GCACCCTGTCGCCATTCCAGAGG + Intergenic
1057878045 9:98772597-98772619 CCCCACTGTGGGCACTCCTAAGG + Intronic
1058177612 9:101755647-101755669 GCTCCCTGTGGGATCTGCTGAGG - Intergenic
1061578807 9:131524217-131524239 GCACCTTGGGGGCTCCCCTGAGG + Exonic
1062117621 9:134817872-134817894 CCACCCTCTGGGCTCCCCTGGGG - Intronic
1062184640 9:135211480-135211502 GCACCCAGGGGGGGCTCCTGTGG - Intergenic
1062427413 9:136512361-136512383 GCACCCTCTGCCCGCTCCTGGGG + Intronic
1187519390 X:20000405-20000427 GCTCCCTGTGGGGTCACCTGAGG - Intergenic
1192393001 X:70750751-70750773 TCACACTCTGGGCACTGCTGTGG + Intronic
1193078544 X:77381949-77381971 GCACCCTGCCGCCACTGCTGGGG - Intergenic
1193344509 X:80389088-80389110 GCACCATGTGGCCACTACTAAGG + Intronic
1197961533 X:132011592-132011614 TCACACTGTGGGGACTGCTGTGG + Intergenic
1199676212 X:150191275-150191297 GCACCCTGTGGGCAGCTCAGGGG - Intergenic
1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG + Exonic
1200735502 Y:6789502-6789524 GCATCCTGTAGCCCCTCCTGTGG + Intergenic