ID: 1073325441

View in Genome Browser
Species Human (GRCh38)
Location 10:102642288-102642310
Sequence AAGGGGCGGGGCGTGCTTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073325441_1073325459 17 Left 1073325441 10:102642288-102642310 CCGGAAAGCACGCCCCGCCCCTT No data
Right 1073325459 10:102642328-102642350 TTTCTTTCGCCAGTGCCGGGTGG No data
1073325441_1073325456 13 Left 1073325441 10:102642288-102642310 CCGGAAAGCACGCCCCGCCCCTT No data
Right 1073325456 10:102642324-102642346 CCCGTTTCTTTCGCCAGTGCCGG No data
1073325441_1073325462 27 Left 1073325441 10:102642288-102642310 CCGGAAAGCACGCCCCGCCCCTT No data
Right 1073325462 10:102642338-102642360 CAGTGCCGGGTGGGCCGAACCGG No data
1073325441_1073325458 14 Left 1073325441 10:102642288-102642310 CCGGAAAGCACGCCCCGCCCCTT No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
1073325441_1073325460 18 Left 1073325441 10:102642288-102642310 CCGGAAAGCACGCCCCGCCCCTT No data
Right 1073325460 10:102642329-102642351 TTCTTTCGCCAGTGCCGGGTGGG No data
1073325441_1073325463 30 Left 1073325441 10:102642288-102642310 CCGGAAAGCACGCCCCGCCCCTT No data
Right 1073325463 10:102642341-102642363 TGCCGGGTGGGCCGAACCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073325441 Original CRISPR AAGGGGCGGGGCGTGCTTTC CGG (reversed) Intergenic