ID: 1073325450

View in Genome Browser
Species Human (GRCh38)
Location 10:102642313-102642335
Sequence GAAAGAAACGGGCGCGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073325450_1073325459 -8 Left 1073325450 10:102642313-102642335 CCCCCACCGCGCCCGTTTCTTTC No data
Right 1073325459 10:102642328-102642350 TTTCTTTCGCCAGTGCCGGGTGG No data
1073325450_1073325463 5 Left 1073325450 10:102642313-102642335 CCCCCACCGCGCCCGTTTCTTTC No data
Right 1073325463 10:102642341-102642363 TGCCGGGTGGGCCGAACCGGCGG No data
1073325450_1073325462 2 Left 1073325450 10:102642313-102642335 CCCCCACCGCGCCCGTTTCTTTC No data
Right 1073325462 10:102642338-102642360 CAGTGCCGGGTGGGCCGAACCGG No data
1073325450_1073325460 -7 Left 1073325450 10:102642313-102642335 CCCCCACCGCGCCCGTTTCTTTC No data
Right 1073325460 10:102642329-102642351 TTCTTTCGCCAGTGCCGGGTGGG No data
1073325450_1073325467 19 Left 1073325450 10:102642313-102642335 CCCCCACCGCGCCCGTTTCTTTC No data
Right 1073325467 10:102642355-102642377 AACCGGCGGGTGCCGATTAAAGG No data
1073325450_1073325464 6 Left 1073325450 10:102642313-102642335 CCCCCACCGCGCCCGTTTCTTTC No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073325450 Original CRISPR GAAAGAAACGGGCGCGGTGG GGG (reversed) Intergenic