ID: 1073325452

View in Genome Browser
Species Human (GRCh38)
Location 10:102642315-102642337
Sequence GCGAAAGAAACGGGCGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073325452_1073325467 17 Left 1073325452 10:102642315-102642337 CCCACCGCGCCCGTTTCTTTCGC No data
Right 1073325467 10:102642355-102642377 AACCGGCGGGTGCCGATTAAAGG No data
1073325452_1073325462 0 Left 1073325452 10:102642315-102642337 CCCACCGCGCCCGTTTCTTTCGC No data
Right 1073325462 10:102642338-102642360 CAGTGCCGGGTGGGCCGAACCGG No data
1073325452_1073325464 4 Left 1073325452 10:102642315-102642337 CCCACCGCGCCCGTTTCTTTCGC No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325452_1073325460 -9 Left 1073325452 10:102642315-102642337 CCCACCGCGCCCGTTTCTTTCGC No data
Right 1073325460 10:102642329-102642351 TTCTTTCGCCAGTGCCGGGTGGG No data
1073325452_1073325463 3 Left 1073325452 10:102642315-102642337 CCCACCGCGCCCGTTTCTTTCGC No data
Right 1073325463 10:102642341-102642363 TGCCGGGTGGGCCGAACCGGCGG No data
1073325452_1073325459 -10 Left 1073325452 10:102642315-102642337 CCCACCGCGCCCGTTTCTTTCGC No data
Right 1073325459 10:102642328-102642350 TTTCTTTCGCCAGTGCCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073325452 Original CRISPR GCGAAAGAAACGGGCGCGGT GGG (reversed) Intergenic