ID: 1073325453

View in Genome Browser
Species Human (GRCh38)
Location 10:102642316-102642338
Sequence GGCGAAAGAAACGGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073325453_1073325463 2 Left 1073325453 10:102642316-102642338 CCACCGCGCCCGTTTCTTTCGCC No data
Right 1073325463 10:102642341-102642363 TGCCGGGTGGGCCGAACCGGCGG No data
1073325453_1073325464 3 Left 1073325453 10:102642316-102642338 CCACCGCGCCCGTTTCTTTCGCC No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325453_1073325467 16 Left 1073325453 10:102642316-102642338 CCACCGCGCCCGTTTCTTTCGCC No data
Right 1073325467 10:102642355-102642377 AACCGGCGGGTGCCGATTAAAGG No data
1073325453_1073325460 -10 Left 1073325453 10:102642316-102642338 CCACCGCGCCCGTTTCTTTCGCC No data
Right 1073325460 10:102642329-102642351 TTCTTTCGCCAGTGCCGGGTGGG No data
1073325453_1073325462 -1 Left 1073325453 10:102642316-102642338 CCACCGCGCCCGTTTCTTTCGCC No data
Right 1073325462 10:102642338-102642360 CAGTGCCGGGTGGGCCGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073325453 Original CRISPR GGCGAAAGAAACGGGCGCGG TGG (reversed) Intergenic
No off target data available for this crispr