ID: 1073325458

View in Genome Browser
Species Human (GRCh38)
Location 10:102642325-102642347
Sequence CCGTTTCTTTCGCCAGTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073325444_1073325458 0 Left 1073325444 10:102642302-102642324 CCGCCCCTTCCCCCCCACCGCGC No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
1073325448_1073325458 -9 Left 1073325448 10:102642311-102642333 CCCCCCCACCGCGCCCGTTTCTT No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
1073325441_1073325458 14 Left 1073325441 10:102642288-102642310 CCGGAAAGCACGCCCCGCCCCTT No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
1073325439_1073325458 30 Left 1073325439 10:102642272-102642294 CCCTGTAACTGTACTTCCGGAAA No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
1073325440_1073325458 29 Left 1073325440 10:102642273-102642295 CCTGTAACTGTACTTCCGGAAAG No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
1073325442_1073325458 2 Left 1073325442 10:102642300-102642322 CCCCGCCCCTTCCCCCCCACCGC No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
1073325443_1073325458 1 Left 1073325443 10:102642301-102642323 CCCGCCCCTTCCCCCCCACCGCG No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
1073325449_1073325458 -10 Left 1073325449 10:102642312-102642334 CCCCCCACCGCGCCCGTTTCTTT No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
1073325447_1073325458 -5 Left 1073325447 10:102642307-102642329 CCTTCCCCCCCACCGCGCCCGTT No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
1073325445_1073325458 -3 Left 1073325445 10:102642305-102642327 CCCCTTCCCCCCCACCGCGCCCG No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
1073325446_1073325458 -4 Left 1073325446 10:102642306-102642328 CCCTTCCCCCCCACCGCGCCCGT No data
Right 1073325458 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073325458 Original CRISPR CCGTTTCTTTCGCCAGTGCC GGG Intergenic