ID: 1073325464

View in Genome Browser
Species Human (GRCh38)
Location 10:102642342-102642364
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073325449_1073325464 7 Left 1073325449 10:102642312-102642334 CCCCCCACCGCGCCCGTTTCTTT No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325447_1073325464 12 Left 1073325447 10:102642307-102642329 CCTTCCCCCCCACCGCGCCCGTT No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325451_1073325464 5 Left 1073325451 10:102642314-102642336 CCCCACCGCGCCCGTTTCTTTCG No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325446_1073325464 13 Left 1073325446 10:102642306-102642328 CCCTTCCCCCCCACCGCGCCCGT No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325444_1073325464 17 Left 1073325444 10:102642302-102642324 CCGCCCCTTCCCCCCCACCGCGC No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325450_1073325464 6 Left 1073325450 10:102642313-102642335 CCCCCACCGCGCCCGTTTCTTTC No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325443_1073325464 18 Left 1073325443 10:102642301-102642323 CCCGCCCCTTCCCCCCCACCGCG No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325445_1073325464 14 Left 1073325445 10:102642305-102642327 CCCCTTCCCCCCCACCGCGCCCG No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325453_1073325464 3 Left 1073325453 10:102642316-102642338 CCACCGCGCCCGTTTCTTTCGCC No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325448_1073325464 8 Left 1073325448 10:102642311-102642333 CCCCCCCACCGCGCCCGTTTCTT No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325454_1073325464 0 Left 1073325454 10:102642319-102642341 CCGCGCCCGTTTCTTTCGCCAGT No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325442_1073325464 19 Left 1073325442 10:102642300-102642322 CCCCGCCCCTTCCCCCCCACCGC No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325455_1073325464 -5 Left 1073325455 10:102642324-102642346 CCCGTTTCTTTCGCCAGTGCCGG No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325457_1073325464 -6 Left 1073325457 10:102642325-102642347 CCGTTTCTTTCGCCAGTGCCGGG No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data
1073325452_1073325464 4 Left 1073325452 10:102642315-102642337 CCCACCGCGCCCGTTTCTTTCGC No data
Right 1073325464 10:102642342-102642364 GCCGGGTGGGCCGAACCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073325464 Original CRISPR GCCGGGTGGGCCGAACCGGC GGG Intergenic
No off target data available for this crispr