ID: 1073325545

View in Genome Browser
Species Human (GRCh38)
Location 10:102642596-102642618
Sequence CCGGGCCGTGGCGGGGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073325531_1073325545 9 Left 1073325531 10:102642564-102642586 CCATTGTATACGGCCGGCTGCGG No data
Right 1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG No data
1073325530_1073325545 10 Left 1073325530 10:102642563-102642585 CCCATTGTATACGGCCGGCTGCG No data
Right 1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG No data
1073325524_1073325545 27 Left 1073325524 10:102642546-102642568 CCCCGCTCTGCTCCGAACCCATT No data
Right 1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG No data
1073325526_1073325545 25 Left 1073325526 10:102642548-102642570 CCGCTCTGCTCCGAACCCATTGT No data
Right 1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG No data
1073325534_1073325545 -4 Left 1073325534 10:102642577-102642599 CCGGCTGCGGACTCCCAGGCCGG No data
Right 1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG No data
1073325528_1073325545 15 Left 1073325528 10:102642558-102642580 CCGAACCCATTGTATACGGCCGG No data
Right 1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG No data
1073325525_1073325545 26 Left 1073325525 10:102642547-102642569 CCCGCTCTGCTCCGAACCCATTG No data
Right 1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073325545 Original CRISPR CCGGGCCGTGGCGGGGGCCC CGG Intergenic
No off target data available for this crispr