ID: 1073325574

View in Genome Browser
Species Human (GRCh38)
Location 10:102642673-102642695
Sequence CCTTCCTCGCGGCGGCGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073325561_1073325574 17 Left 1073325561 10:102642633-102642655 CCTCCGGCTGGTCCCGCGGGCCG No data
Right 1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG No data
1073325559_1073325574 19 Left 1073325559 10:102642631-102642653 CCCCTCCGGCTGGTCCCGCGGGC No data
Right 1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG No data
1073325552_1073325574 29 Left 1073325552 10:102642621-102642643 CCCCCGAGTGCCCCTCCGGCTGG No data
Right 1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG No data
1073325566_1073325574 -3 Left 1073325566 10:102642653-102642675 CCGCGGCATCTCCGCCGCCGCCT No data
Right 1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG No data
1073325565_1073325574 4 Left 1073325565 10:102642646-102642668 CCGCGGGCCGCGGCATCTCCGCC No data
Right 1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG No data
1073325555_1073325574 27 Left 1073325555 10:102642623-102642645 CCCGAGTGCCCCTCCGGCTGGTC No data
Right 1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG No data
1073325562_1073325574 14 Left 1073325562 10:102642636-102642658 CCGGCTGGTCCCGCGGGCCGCGG No data
Right 1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG No data
1073325564_1073325574 5 Left 1073325564 10:102642645-102642667 CCCGCGGGCCGCGGCATCTCCGC No data
Right 1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG No data
1073325556_1073325574 26 Left 1073325556 10:102642624-102642646 CCGAGTGCCCCTCCGGCTGGTCC No data
Right 1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG No data
1073325560_1073325574 18 Left 1073325560 10:102642632-102642654 CCCTCCGGCTGGTCCCGCGGGCC No data
Right 1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG No data
1073325554_1073325574 28 Left 1073325554 10:102642622-102642644 CCCCGAGTGCCCCTCCGGCTGGT No data
Right 1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073325574 Original CRISPR CCTTCCTCGCGGCGGCGGCG AGG Intergenic
No off target data available for this crispr