ID: 1073325949

View in Genome Browser
Species Human (GRCh38)
Location 10:102644079-102644101
Sequence GGCGAGGGCGGCCGCGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 334}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073325949_1073325967 17 Left 1073325949 10:102644079-102644101 CCCTCGGCGCGGCCGCCCTCGCC 0: 1
1: 1
2: 2
3: 33
4: 334
Right 1073325967 10:102644119-102644141 CCGGGCTCCGGCCCCTGCGAGGG 0: 1
1: 0
2: 1
3: 19
4: 198
1073325949_1073325965 16 Left 1073325949 10:102644079-102644101 CCCTCGGCGCGGCCGCCCTCGCC 0: 1
1: 1
2: 2
3: 33
4: 334
Right 1073325965 10:102644118-102644140 CCCGGGCTCCGGCCCCTGCGAGG 0: 1
1: 0
2: 5
3: 36
4: 379
1073325949_1073325957 -1 Left 1073325949 10:102644079-102644101 CCCTCGGCGCGGCCGCCCTCGCC 0: 1
1: 1
2: 2
3: 33
4: 334
Right 1073325957 10:102644101-102644123 CTCCTGGCCCCGCAGACCCCGGG 0: 1
1: 0
2: 0
3: 42
4: 436
1073325949_1073325968 20 Left 1073325949 10:102644079-102644101 CCCTCGGCGCGGCCGCCCTCGCC 0: 1
1: 1
2: 2
3: 33
4: 334
Right 1073325968 10:102644122-102644144 GGCTCCGGCCCCTGCGAGGGAGG 0: 1
1: 0
2: 0
3: 31
4: 295
1073325949_1073325959 5 Left 1073325949 10:102644079-102644101 CCCTCGGCGCGGCCGCCCTCGCC 0: 1
1: 1
2: 2
3: 33
4: 334
Right 1073325959 10:102644107-102644129 GCCCCGCAGACCCCGGGCTCCGG 0: 1
1: 0
2: 3
3: 36
4: 345
1073325949_1073325956 -2 Left 1073325949 10:102644079-102644101 CCCTCGGCGCGGCCGCCCTCGCC 0: 1
1: 1
2: 2
3: 33
4: 334
Right 1073325956 10:102644100-102644122 CCTCCTGGCCCCGCAGACCCCGG 0: 1
1: 0
2: 10
3: 38
4: 484
1073325949_1073325970 25 Left 1073325949 10:102644079-102644101 CCCTCGGCGCGGCCGCCCTCGCC 0: 1
1: 1
2: 2
3: 33
4: 334
Right 1073325970 10:102644127-102644149 CGGCCCCTGCGAGGGAGGTGCGG 0: 1
1: 1
2: 3
3: 25
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073325949 Original CRISPR GGCGAGGGCGGCCGCGCCGA GGG (reversed) Intergenic
900382556 1:2392035-2392057 GGCGGGCGGGGCCGCGCTGAGGG + Intronic
900549541 1:3247404-3247426 GGCGAGGGCGGCCGGGCCGAGGG + Intronic
901011797 1:6206450-6206472 GGCGCGGGCGCCCGGGCAGAGGG + Intronic
901022174 1:6261031-6261053 GGCGGCGGCGGCGGCGCCTAGGG - Intergenic
901279965 1:8026305-8026327 GGCGGCGGCAGCCGCGGCGACGG - Exonic
901836347 1:11926294-11926316 GGCGCGGGCGGCCGGGCCGGTGG - Exonic
902336792 1:15758751-15758773 GGGGAGGGCGGACGGGCGGAGGG + Intronic
902823238 1:18956232-18956254 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
902951017 1:19882750-19882772 AGCGAGGGAGGCGGCGCCGGGGG + Intronic
903232665 1:21931429-21931451 GAAGAGGGAGGCTGCGCCGAGGG - Intronic
904822732 1:33256176-33256198 GGCGGCGGCGGCGGCGGCGACGG + Intergenic
904941067 1:34165098-34165120 GGCGCGGCCGGCAGCGCCGAGGG + Exonic
905741326 1:40373911-40373933 GCCAAGGGGCGCCGCGCCGAGGG + Exonic
906636975 1:47416385-47416407 GGCGACGGCGGCGGCCCCGACGG - Exonic
907905665 1:58782483-58782505 GGCCAGGCCGGCCGCGCCGTAGG + Exonic
908581901 1:65525501-65525523 GGCTAGGGCGGTCGCGCAGGTGG - Intronic
910145727 1:84078095-84078117 GGCGGCGGCGGCGGCGGCGACGG - Intronic
910277531 1:85464998-85465020 GGCGTGGGTGGCCCGGCCGAAGG + Exonic
911073184 1:93847905-93847927 GGCGGCGGCGGCGGCGGCGAAGG + Intergenic
914803168 1:150974776-150974798 GGCGGCGGCGGCGGCGCCGGCGG - Exonic
915552247 1:156642036-156642058 GGCGGGGGCGGCCCCGGGGAGGG + Exonic
915616824 1:157045744-157045766 GGCGAGCGCGGCCGCGACGCCGG - Intergenic
918142800 1:181732837-181732859 GGCGATGCCGGCTGCGCCGTTGG - Exonic
919678485 1:200409954-200409976 GGCGACGGCGGCTGCGGCGGCGG - Exonic
920528504 1:206685320-206685342 GGCGGCGGCGGCTGCGCCGGGGG - Exonic
923107904 1:230868549-230868571 GGCGAGGGCGGGCACAGCGAGGG - Exonic
923171553 1:231421889-231421911 GGCGGCGGCGGCGGCGGCGACGG + Exonic
923369429 1:233295584-233295606 GGCGACGGCGGCGGCGACGGCGG - Exonic
1062774550 10:135032-135054 TCCGAGGGCGGGCGGGCCGAGGG + Intronic
1064185499 10:13158545-13158567 GGAGAGGGCGGCGGCGGCGGTGG - Intergenic
1064274195 10:13891767-13891789 GGCGGGGGCGGCGGCGGGGACGG - Intronic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1067337055 10:45374498-45374520 GGCCTGGGCGGGGGCGCCGAGGG + Intronic
1071997562 10:91162983-91163005 GGTGAGGGAGCCCGCGCCGGCGG - Intergenic
1072713952 10:97737146-97737168 GGCGGTGGCGGCCGCGGCGTAGG + Exonic
1073325949 10:102644079-102644101 GGCGAGGGCGGCCGCGCCGAGGG - Intergenic
1076130096 10:128008203-128008225 GGCGAGGGCGGACGAGCCAGCGG - Intronic
1076372496 10:129964393-129964415 GGCGAGCGCGGCGGCGGCGGCGG - Intergenic
1076395860 10:130136817-130136839 GGCCTGGGCGGCCCCGCCGCGGG + Intronic
1076638918 10:131901031-131901053 GGCGGCGGCGGCGGCGCCGGCGG + Exonic
1076793333 10:132787714-132787736 GGCGACGGCGCCCGCGCCCAAGG + Intergenic
1076916526 10:133425140-133425162 GCCCAGGGCGGCCGCGCCTCCGG + Intergenic
1076936630 10:133569935-133569957 GCCCAGGGCGGCCGCGCCTCCGG + Intergenic
1077076990 11:706411-706433 TTGGAGGGCGGCCGGGCCGAGGG + Intronic
1077319710 11:1935743-1935765 GGGGAGGGCGGCTGTGCCCACGG + Intronic
1080503666 11:32892845-32892867 GGCGACGGCGGCGGCGGCGGCGG - Intergenic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1080606601 11:33869484-33869506 GGCGACGGCGGCGGCGGCGGCGG - Exonic
1081528659 11:43943439-43943461 GGCCAGGGCGAGCGCGGCGAGGG - Intronic
1081872998 11:46391689-46391711 GGGGCGGGCGGCCGGGCCGAGGG + Intergenic
1083595550 11:63916969-63916991 GGCGGCGGCGGCGGCGGCGACGG + Intergenic
1084517191 11:69643361-69643383 AGGGAGGGCGGCCCCGCCGCCGG + Intronic
1088400879 11:109422128-109422150 GGCGAAGGCGGCGGCGGCGGCGG + Exonic
1088764343 11:112961892-112961914 GGGAAGGGCGGACGCGCCGGAGG - Intronic
1092169311 12:6363421-6363443 GGTGAGGCCCGCAGCGCCGAGGG - Exonic
1093435251 12:19129495-19129517 GGAGGGGGCGGGCGCGCCGCAGG + Intergenic
1095261663 12:40105624-40105646 GGCGCGGGCGGCGGCGGCGTCGG - Exonic
1096116810 12:49059959-49059981 GGCGCGGGCGGCCGGGGCGCTGG - Intergenic
1096403190 12:51324113-51324135 GGCCAGGGCGGCGGCCCCCAGGG - Exonic
1096491361 12:52014894-52014916 GGCGGGGGCGGCAGCGCCGGCGG - Exonic
1096710525 12:53452262-53452284 GGCGAGGGGGGCCCCGCGGGCGG - Exonic
1096774404 12:53955371-53955393 GGCGACGGCGGCGGCGGCGCAGG + Exonic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1097891448 12:64781106-64781128 GGCGGGGGCCGCGGGGCCGAGGG + Intergenic
1097929632 12:65169842-65169864 GGCGGCGGCGGCCGCGGGGATGG + Exonic
1098288455 12:68933038-68933060 GGCGCGGGCGGCTGGGTCGAGGG - Intronic
1102973604 12:117190387-117190409 GGCGGAGGAGGCCGCGCCGGAGG - Exonic
1103570152 12:121839562-121839584 GCAGAGGGCGGCCCCGCCGAGGG + Exonic
1103604867 12:122078981-122079003 GGCCGGGGTGGCCGCGCCGGAGG - Exonic
1103626877 12:122226402-122226424 GGCGGGGCCGGGCGCGGCGACGG + Exonic
1103764668 12:123271660-123271682 CGCGAGGGCGGCGGCGGCGGCGG + Exonic
1104444714 12:128823865-128823887 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1104635686 12:130436859-130436881 GGCCCGGGAGGCCGCGCAGAGGG - Exonic
1104857631 12:131909444-131909466 GGCGAGGGAGGCCTTGCCGGGGG - Intronic
1104881870 12:132077430-132077452 GGCGACGGCGGCCGGGCAGCAGG + Exonic
1104891868 12:132144078-132144100 GGCGACGGCGGCCCCGGCGGCGG - Exonic
1104983305 12:132583360-132583382 GGCGGGGGCGGCAGCGGGGAAGG - Exonic
1105378115 13:19863361-19863383 GGCGACGGCGGCCGCGCCGCGGG + Intronic
1105389141 13:19959004-19959026 GGCGACGGCGGCCGCGCCGCGGG - Intronic
1106776645 13:33016256-33016278 GGCGGGGGCAGGGGCGCCGAGGG - Intergenic
1107467636 13:40665125-40665147 GGCGGGGGAGGGCGCGGCGAGGG - Intronic
1108541686 13:51452332-51452354 GGGGAGGGCGGCCGGGGCGGGGG - Intronic
1108689151 13:52846800-52846822 GCCGAGGTGGGCCGCGCCGGGGG - Exonic
1108689271 13:52847309-52847331 GGCGGCGGCGGCAGCGGCGAAGG + Exonic
1108727782 13:53201087-53201109 GGCGGCGGCGGCAGCGGCGAAGG - Intergenic
1108727914 13:53201617-53201639 GCCGAGGTGGGCCGCGCCGGGGG + Intergenic
1110318203 13:74134291-74134313 GGCGGGGGCGGCGGCGGGGAGGG + Intergenic
1112505084 13:99970585-99970607 GGCGGCGGCGGCGGCGCCGGGGG + Exonic
1113655926 13:112067761-112067783 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
1113656118 13:112068561-112068583 GGCGGCGGCGGCCGCGTCGTCGG + Exonic
1113912407 13:113849249-113849271 TGGGAGGGCGGCCGCCCTGAAGG + Intronic
1114461153 14:22886952-22886974 GGCGAGGGGGGGCGAGCGGAGGG - Exonic
1114519003 14:23321466-23321488 GGCGATGGCGGCGGCGGCGGCGG + Exonic
1115474570 14:33800609-33800631 GGCGGGGGCGGCGGCGCGGGGGG + Exonic
1116886985 14:50231464-50231486 GGCGAGGGCCGCCTCGGCGGAGG - Exonic
1116945218 14:50830438-50830460 GGCGAGGGCGGCGGGGCCGGGGG - Intronic
1118289096 14:64504148-64504170 GGCCAGGGAGGCCGAGCCGCGGG + Intronic
1118854623 14:69611554-69611576 GGCGGGGGAGGCCCCGCGGAGGG - Intergenic
1119003983 14:70907810-70907832 GGCGGCGGCGGCGGCGGCGACGG + Exonic
1120167860 14:81220262-81220284 GGGGAGGGCGGGGGCGCCGGTGG - Intronic
1120167904 14:81220361-81220383 GGCGGCGGCGGCCGCGCGGGCGG + Intronic
1121253013 14:92513638-92513660 GGCCCGGGCGGCCGCGCCCCCGG - Intergenic
1121368112 14:93332939-93332961 GGAGAGGGCGGCGGCGGCGGCGG - Exonic
1122130811 14:99603923-99603945 GGCGACGGCGGCGGCGGCGTCGG - Exonic
1122620934 14:103057402-103057424 TGGGAGGGCGGCGGCGCCGAGGG - Exonic
1122975375 14:105168683-105168705 GGCGACGGCGGCGGCGGTGAAGG + Exonic
1122993302 14:105248988-105249010 GGCGCGGGCGGCGGCGGCGCTGG - Exonic
1126736618 15:51737534-51737556 CGCGAGCGCGGCGGCGGCGAGGG + Exonic
1126767007 15:52019449-52019471 GGCGGCGGCGGCGGCGGCGACGG + Intronic
1127931746 15:63601437-63601459 GGCCAGGGCTGCCGCGCGCAGGG + Exonic
1128309694 15:66622362-66622384 GGCCAGGGCCGCCGTGGCGACGG + Intronic
1128370055 15:67033857-67033879 GGAGAGCGCGGCCGCGGCGGGGG - Intergenic
1129052845 15:72796991-72797013 CGCGAGAGCGGCCGCGGCGCGGG + Intergenic
1129450237 15:75647550-75647572 GGCGAGGGCGGACAGGCGGAGGG + Intronic
1129450453 15:75648345-75648367 GGAGAGGGCGCCCGAGCCGGCGG + Exonic
1130305455 15:82709801-82709823 GGCGAAGGCGGCGGCGCGGCAGG + Intronic
1132607733 16:800543-800565 GGCGAGGGCAGCTGCCCCGCAGG - Intronic
1132851468 16:2026801-2026823 GGCGGGGGCGGCCGGGCGGCGGG + Intronic
1132977891 16:2719681-2719703 TGGGAGGGTGGCCGAGCCGAGGG - Intronic
1133212874 16:4272869-4272891 GGCGGCGGCGGCGGCGGCGAGGG + Exonic
1134531984 16:14990217-14990239 GGCACGGGCGGCCGGGCCGGTGG - Intronic
1135383009 16:22009058-22009080 GGCGGGGGCGGCGGTGCAGAGGG - Intronic
1136110898 16:28063221-28063243 GGCGGGGGCGGCGGTGCCGTTGG + Exonic
1136146643 16:28320304-28320326 TGCCAGGCGGGCCGCGCCGACGG + Exonic
1139917806 16:70439019-70439041 GGCGGCGGCGGCGGCGGCGACGG - Intronic
1140723130 16:77788755-77788777 GCGGAGGGCGGCGGCGGCGACGG + Exonic
1141830124 16:86505747-86505769 CGCGAGGGCAGCCGCCCCGCCGG - Intergenic
1141840106 16:86568524-86568546 GGCGGGGGCGGCGGCGCCTGCGG - Exonic
1141989748 16:87602984-87603006 GGCGCGGGCGGCCGCGGCGCCGG - Exonic
1142090433 16:88206923-88206945 GGGGAGGGAGGCCGCGGGGACGG + Intergenic
1142090542 16:88207150-88207172 GGGGAGGGAGGCCGCGGGGACGG + Intergenic
1142173339 16:88634091-88634113 GGTGGGGGCGGCCGCGCCGCAGG + Intergenic
1142664586 17:1455640-1455662 GGGGAGGGCAGCCGCGGGGAAGG - Intronic
1143016431 17:3893234-3893256 GGCGAGGTCGGCCCCGCCGCAGG - Intronic
1143188258 17:5023564-5023586 GGCGAGGGGGGCCGGGCTGACGG - Exonic
1143390400 17:6556363-6556385 GGTGAGGGCGGGCGCGGGGAGGG - Exonic
1143590781 17:7885056-7885078 GGCGGGGGCGGCGGCGGCGGGGG - Exonic
1143747291 17:9003632-9003654 AGCGAGGGGTGCAGCGCCGAGGG - Intergenic
1143904693 17:10198928-10198950 GGCCAGGGCGGCCACGCCCGCGG + Intergenic
1144656950 17:17042814-17042836 GGCGACGGCGGCGGCGGCGGCGG - Exonic
1146398561 17:32487012-32487034 GGCGACGGCGGCGGCGGCGGCGG - Exonic
1146793196 17:35764467-35764489 GGCGACGACCGCCGCGCCGCGGG + Exonic
1147307399 17:39573622-39573644 GGCGGCGGCGGCGGCGGCGATGG - Intergenic
1147406981 17:40219381-40219403 GGCGGCGGCGGCGGCGGCGACGG + Exonic
1147994708 17:44354412-44354434 GGCGAGGGCGGCGGGGGCGGCGG - Exonic
1148060085 17:44830177-44830199 GGCGAAGGCGGCAGCGGCGGAGG - Intronic
1148128159 17:45247463-45247485 GGCGAGGGAGCCCGCTTCGAGGG + Intergenic
1148337481 17:46851451-46851473 GGCGAGGGCGGTGGGGCCAATGG + Intronic
1148467234 17:47872501-47872523 GGCGGCGGCGGCGGCGGCGATGG + Intergenic
1149430730 17:56594139-56594161 GGGGAGCGCGGCGGCGCCGCGGG + Exonic
1150267804 17:63842396-63842418 TGCGAGGGCGCCCGGGCCGGCGG - Intronic
1150791966 17:68205968-68205990 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1152612844 17:81323988-81324010 GGAGTGGGGGGCCGCGCCGGGGG + Intronic
1152921005 17:83066677-83066699 GGGGCGGGCAGCCGCGCCCATGG - Intergenic
1152924479 17:83080847-83080869 GGGGGCGGGGGCCGCGCCGAGGG - Intronic
1153514490 18:5891374-5891396 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1154015497 18:10612746-10612768 AGAGAGGGCTGCAGCGCCGAGGG - Intergenic
1154190013 18:12222885-12222907 AGAGAGGGCTGCAGCGCCGAGGG + Intergenic
1154202336 18:12308188-12308210 GGCGGGGGCGGGGGCGCGGAGGG + Exonic
1155392467 18:25351041-25351063 CGCGAGGGAGGCCGAGCGGAGGG - Intronic
1155507631 18:26548421-26548443 GGCGAGGGCGAGCGCGGCGCGGG - Intronic
1155654572 18:28178002-28178024 GGCGAGGGCGGCGGCGGCGGCGG - Intergenic
1155910330 18:31498139-31498161 GGAGAGGGTGGCCGGGCCGGGGG + Exonic
1157383934 18:47247073-47247095 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1158643389 18:59221275-59221297 GGAGAGGACGGCCGCGCTGCGGG + Intronic
1158976622 18:62716135-62716157 GGGGAGGCCGGCAGCGCCGGGGG - Exonic
1159798102 18:72867777-72867799 GGCGGCGGCGGCGGCGCCGGCGG + Exonic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160930589 19:1568000-1568022 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1161114553 19:2489275-2489297 GCGGCGGGCGGCCGGGCCGAGGG + Intergenic
1162502149 19:11060111-11060133 GCCGGCGGCGGCCGAGCCGAGGG + Exonic
1162778651 19:12995607-12995629 GGCGAGCGCGGCGGCGGCGGCGG + Exonic
1162832967 19:13298640-13298662 GGCGAGGGCGAGGGCCCCGACGG - Exonic
1163584831 19:18157848-18157870 TGCCAGGGCGTCCCCGCCGAGGG + Intronic
1163631298 19:18419300-18419322 GGCGATGGCGGGCGCGCGGGTGG - Intronic
1165080046 19:33301843-33301865 TGCGAGGGCGGCGGCGGCGGCGG + Exonic
1166211651 19:41310322-41310344 GGCGACGGCGACGGCGGCGAAGG + Exonic
1166245423 19:41522228-41522250 GGCGGCGGCGGCCGCGACAACGG + Intergenic
1166888256 19:45973956-45973978 GGCGCGGGCGGCGGCGGCGACGG + Intergenic
1166948959 19:46413683-46413705 GGGGAAGGAGGCCGCCCCGAAGG - Intergenic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167578329 19:50328316-50328338 GACGCGGGCGGCGGCGCCGGGGG - Exonic
1167738656 19:51311642-51311664 GGGGAGGGGGGCGGCGCTGACGG - Intergenic
1167924111 19:52809817-52809839 GGCGAAGGCGGCGGCGGCGGCGG + Intronic
1168076327 19:53982550-53982572 GGCGGCGGCGGCGGCGCCGTGGG + Exonic
1168332398 19:55578217-55578239 GGAGAGGGCCGCCGCGCTGCAGG - Exonic
1168339514 19:55615133-55615155 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
926089875 2:10043194-10043216 GGCGGGGGCGGCGGGGCGGAGGG - Intronic
926275843 2:11402638-11402660 GGCGATGGCGGCAGCGGCGGTGG - Intergenic
932621869 2:73269454-73269476 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
932699695 2:73984631-73984653 GGCGAGGGTGGCCAACCCGAAGG + Intergenic
932699852 2:73985068-73985090 GGCGGCGGCGGCCGCGACGGTGG + Intergenic
933684713 2:85133700-85133722 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
934712958 2:96527621-96527643 GGGGGGCGCGGCCGCGCCGCTGG + Intergenic
935592461 2:104855344-104855366 GGCGAAGGCGGCGGGGCCGGCGG + Intergenic
936122683 2:109760395-109760417 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
936126712 2:109794618-109794640 GGCGGCGGCGGCCGCCTCGATGG + Intronic
936217985 2:110576868-110576890 GGCGGCGGCGGCCGCCTCGATGG - Intronic
936222010 2:110611078-110611100 GGCGGGGGCGGCGGCGGCGGCGG - Intergenic
938069043 2:128298915-128298937 GCCCAGGGTGGCCGCGCCCAGGG - Intronic
938406244 2:131034875-131034897 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
939629758 2:144517165-144517187 GGCGGCGGCGGCGGCGCCCAGGG - Intronic
940918892 2:159286561-159286583 GGTGAGAGCGGCCGCGCCCACGG - Exonic
941020852 2:160407272-160407294 GGCCCGGGCGGCGGCGGCGAGGG + Intronic
941911686 2:170770815-170770837 GGGGCGGGCGGCCGAGCTGAGGG - Intergenic
942346217 2:175005264-175005286 GGCGGCGGCGGCGGCGGCGACGG + Intronic
942450923 2:176107635-176107657 GGCGGGGGCGGCGGCGGCGCGGG + Exonic
942453666 2:176123410-176123432 GGAGAAGGCGGCAGCGGCGACGG + Exonic
942681345 2:178480611-178480633 GGCGGCGGCGGCCGCGACAACGG - Exonic
944715905 2:202376175-202376197 GGCGGCGGCGGCGGCGCCGGCGG - Intergenic
945649020 2:212537559-212537581 GGCGAAAGCGGCAGCGGCGATGG - Intronic
946431348 2:219628587-219628609 GGCGAGGGCGGCCGCACTAGGGG - Intronic
946921434 2:224585171-224585193 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947549776 2:231037820-231037842 GGCGAGGGCGGCTGGGGCGGCGG + Exonic
947549784 2:231037838-231037860 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947669169 2:231925867-231925889 GGCGAAGGCGGCCGCGTGGCAGG - Intronic
948207941 2:236172800-236172822 GGCGGGCGCTGTCGCGCCGACGG + Intergenic
948487249 2:238288748-238288770 GGCGGAGGCGGCGGCGCTGAGGG - Intronic
948981327 2:241496376-241496398 GGTGAGGGCGGCCGTGCCATAGG - Exonic
1169211352 20:3767757-3767779 CGGGAGGGCGGCCGCGGCGCGGG - Intronic
1171769964 20:29314713-29314735 GGGGAGGGTGGCCGCGCTGGAGG + Intergenic
1172064138 20:32207511-32207533 GGTGTGGGCGACCGCGCTGAGGG + Intronic
1172252560 20:33490090-33490112 GGCGGCGGCGGCGGCGGCGACGG + Intronic
1172474461 20:35226684-35226706 GGCGGCGGCGGCGGCGGCGAAGG + Exonic
1173807421 20:45934949-45934971 CGGGTGGGCGGCCGCGCCGGTGG + Intronic
1174343867 20:49915392-49915414 GCCGAGGACGGCCCGGCCGAGGG + Intronic
1176062251 20:63177603-63177625 GGCGACGGCGGCGGCGGCGGCGG + Intergenic
1176157098 20:63627297-63627319 CGCGCGGGCGGCCGGGCCGAGGG + Intergenic
1176234838 20:64049388-64049410 GGCGAGGGCGGCGGGGCCGGCGG + Exonic
1178610238 21:34073491-34073513 GGCGGGGCGGGGCGCGCCGAGGG + Intronic
1178680848 21:34670640-34670662 GCCGAGGAGGGCCCCGCCGAGGG + Exonic
1178992635 21:37367703-37367725 GCCGAGGCCGGCCGGGCGGAGGG + Intronic
1179674890 21:42974689-42974711 GGCGAGAGCGGCGGCGGCGGCGG - Intronic
1180095940 21:45555333-45555355 GGCGGGGGCGGCAGCGCTGCAGG + Intergenic
1180559231 22:16601991-16602013 GGCGGCGGCGGCCGCGGCGGCGG + Intergenic
1180722195 22:17917717-17917739 GGCCAGGGCAGCCCCGCCCAGGG - Intronic
1180949416 22:19714473-19714495 GGCGGCGGCGGCGGCGCGGAGGG + Exonic
1181057844 22:20268294-20268316 GGCGAGGGCGGCGGCGGCGCGGG + Exonic
1181934618 22:26429606-26429628 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
1183299460 22:37051797-37051819 GGGGCGGGCGGCCGCGCCGCAGG + Exonic
1183773482 22:39947030-39947052 GGGGAGGGCAGCAGAGCCGATGG - Intronic
1184680920 22:46071729-46071751 GGCGGGGACGGCGGCGCCGCGGG + Intronic
950509978 3:13420252-13420274 GGCGCGGGCGGCCGGGCGCAGGG - Exonic
951217749 3:20040562-20040584 GGCGCGGGCGGAAGCGCCGCAGG - Exonic
953909286 3:46883516-46883538 GGCGGCGGCGGCTGCCCCGAGGG + Exonic
953989877 3:47475826-47475848 GGCGGCGGCGGCGGCGGCGACGG + Exonic
954003043 3:47572772-47572794 GACGAGGGCAGCCGAGCCCACGG + Exonic
954649847 3:52154373-52154395 GGCGGGGCTGGCGGCGCCGAAGG + Exonic
955387609 3:58492061-58492083 GGCGACGGCGGCGGCGGCGGCGG - Intergenic
957939870 3:86991054-86991076 CGCGAGGGCTGCGGCGCCCACGG + Exonic
961377284 3:126475509-126475531 GGGGGGGGCGGCCGGGCCGCTGG + Exonic
961446414 3:126983595-126983617 GGCGGGGGAGGCCGCGGCGCTGG - Intergenic
961735931 3:129002159-129002181 GGCGGCGGCGGCGGCGCGGACGG - Exonic
962230566 3:133661948-133661970 GGCAAGCGCGGCCGCGCGGTTGG - Intergenic
963335985 3:143973162-143973184 GCCGAGGGCGACCCCGCTGATGG + Intronic
964509733 3:157437679-157437701 GGCGAGGCCGTGCGCGCCGGGGG + Exonic
965390171 3:168095300-168095322 GGCGGGGGCGGCCGCGGCTTTGG - Exonic
966362828 3:179148526-179148548 GGCGGCGGCGGCGGCGCCGAGGG - Exonic
966850908 3:184164563-184164585 AGCGAGAGCGGCCACGCCGGAGG + Exonic
966883219 3:184361461-184361483 GGAGATGGCGGCCGCGGCGGCGG - Exonic
967924186 3:194633381-194633403 GGCGCGGGCGGCGGCGGCGAAGG + Exonic
968701207 4:2059097-2059119 GGCGGGGGCGGCGGCGCGGGCGG - Intergenic
970441388 4:16083506-16083528 GGCCAGGGAGGCGGCGCAGATGG + Intronic
971288443 4:25312678-25312700 GGCGGGGGCTGCCGCGGCGGAGG - Intergenic
975778964 4:77819617-77819639 GGCGGCGGCGGCGGCGGCGACGG + Intergenic
980130069 4:128809978-128810000 GGCGACGGCGGCGGCGGCGGCGG + Intronic
982198174 4:152936433-152936455 GGCGGGGGCGACCGCGGCGCGGG + Intronic
982260333 4:153488807-153488829 GGCGAGGGCGGACTCCCCGAGGG - Intronic
984639301 4:182144625-182144647 GGGGAGGGGGGCCCCGCCGAGGG - Intronic
984734558 4:183098303-183098325 GGTGTGGGCGGCCACGCCGGAGG - Intergenic
984778909 4:183506033-183506055 GGGGAGGGCCCCCGCGCCGGGGG + Intronic
985532685 5:443224-443246 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
985588557 5:753216-753238 CGCGAGGGAGGCCGAGCTGATGG - Intronic
985603224 5:845655-845677 CGCGAGGGAGGCCGAGCTGATGG - Intronic
985890294 5:2710155-2710177 GGCGAGGGAGGCTGCGCAGGTGG + Intergenic
986993267 5:13578598-13578620 GGGGCGGCCGGCCGCTCCGAGGG - Intergenic
988564833 5:32312705-32312727 GGCAGGGGCGGCCGGGGCGAGGG - Intronic
990825460 5:59893429-59893451 GGCGAGGGTGGCGGCGGCGGGGG + Exonic
990910101 5:60844070-60844092 GGGGAGGGAGGCAGAGCCGAGGG - Intronic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
992487494 5:77210574-77210596 GGCGGCGGGGGCCGCGCCGAGGG + Intronic
992530142 5:77645317-77645339 GGCGACGGCGGCGGCGGCGCGGG - Intergenic
992828146 5:80569721-80569743 GGCGAGGGCTGCCCGGCCGCGGG - Intronic
993900979 5:93584327-93584349 GGCGAGGGCGGAGGCGGCGGCGG - Exonic
994043542 5:95284442-95284464 GGCGGGGGCGGGCGCGCTGGGGG - Exonic
994072823 5:95620837-95620859 GGCGGCGGCGGCAGCGGCGAGGG - Exonic
998836094 5:146203900-146203922 GGCGTGGGGGGCGGCGCTGAGGG + Intronic
1000302888 5:159972048-159972070 GGCGACGGCGGCGGCGGCGTCGG - Exonic
1001065082 5:168529604-168529626 GGCAAGGGCGGCGGGGGCGACGG + Exonic
1001688800 5:173616585-173616607 GGTGGGGGCGGCGGCGGCGAAGG + Exonic
1002258519 5:177977995-177978017 GCCCAGGGCGGCCGCCCCCAGGG + Intergenic
1002927344 6:1611900-1611922 GGCGAGCGCGGCGGCGGCGGCGG + Exonic
1003624083 6:7727028-7727050 GGCAAGGGCGGCCGCAGCGGCGG - Exonic
1003824948 6:9942456-9942478 GGCGAGGGCAGGGGCGGCGAGGG - Intronic
1004044739 6:12012603-12012625 GGGGAGGGCGGCGGGGCGGAGGG + Intronic
1004262077 6:14117571-14117593 GGCGAGGGCGGCGGGTGCGACGG + Intronic
1004615043 6:17281432-17281454 GGCGAGGGCGGCGGCGCGGCGGG - Exonic
1005135981 6:22570112-22570134 GGAGAGGGCGGCGGCGGCGGCGG + Exonic
1005135983 6:22570121-22570143 GGCGGCGGCGGCGGCGGCGACGG + Exonic
1006677806 6:35776740-35776762 GGAGAGGGTGGCCCCGCCGCCGG + Intronic
1007451143 6:41941085-41941107 GGCGGGGGCGGCCGAGCCCAGGG + Intronic
1008092842 6:47309707-47309729 CGCCTGGGCGGCCGCGCCGCTGG - Exonic
1008932470 6:56954938-56954960 GGCCCGGGCGGCCGCGGCGGCGG - Intergenic
1011099844 6:83708894-83708916 GCCGAGGGAAGCCGCGCCGGTGG + Intronic
1011226614 6:85114982-85115004 GGCGGGGGCGGGGGCGCCGGGGG + Intergenic
1013117564 6:107114738-107114760 GGCGGCGGCGGCGGCGCGGACGG + Intronic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1013349195 6:109290549-109290571 AGCGACGGCCGCCGCTCCGAGGG + Intergenic
1013538773 6:111087627-111087649 GGCGAGGGCGGCGGAGCCCCTGG - Exonic
1016714108 6:147204112-147204134 GGCGACGGTGGCGGCGCCGGGGG + Intergenic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1017672310 6:156778946-156778968 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1019828226 7:3301272-3301294 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1020274291 7:6615496-6615518 GGCGACGGCGGCGGCGGCGGCGG + Intergenic
1027041502 7:74964768-74964790 GGCGAGGGAGGCAGCGCCGGCGG - Intergenic
1027082140 7:75237601-75237623 GGCGAGGGAGGCAGCGCCGGCGG + Intergenic
1029367766 7:100127498-100127520 GGCGATGCCGTGCGCGCCGACGG + Exonic
1029390719 7:100272147-100272169 GTCGAGGGAGGCAGCGCCGGCGG + Exonic
1029456206 7:100673809-100673831 GGCGGCGGCGGCGGCGCGGATGG - Exonic
1029996758 7:105014165-105014187 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1030820726 7:114087623-114087645 GGCGGCGGCGGCGGCGCCGGCGG + Intronic
1032391162 7:131556277-131556299 GGCGACGGCGACGGCGACGACGG + Exonic
1033227251 7:139571832-139571854 AGCTAGGGTGGCGGCGCCGAGGG + Exonic
1033654345 7:143362762-143362784 GGCGGCGGCGGCGGCGGCGACGG - Intronic
1034034079 7:147801853-147801875 GGGGGGGGCGGCCGGGCAGAGGG + Intronic
1034306279 7:150047658-150047680 GGCGGCGGCGGCGGCGCGGATGG - Intergenic
1034618016 7:152435838-152435860 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1034911708 7:155003083-155003105 GGCGCGGGCGGGGGCGCGGAGGG - Exonic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1035752058 8:2002927-2002949 GGCGAGGCCGGCGGCGACGCAGG + Exonic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1037920925 8:22804914-22804936 GGACAGGGCAGCCGGGCCGAGGG - Intronic
1039311580 8:36322417-36322439 GGCCAGGGCGGCCACGGAGAAGG - Intergenic
1040065354 8:43140469-43140491 GGCAAGGGCGGCCGAGCGGGCGG + Exonic
1041690396 8:60680409-60680431 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1043854150 8:85245624-85245646 GGGGAAGGCGCCCGCGCCGCTGG - Exonic
1048244144 8:132775407-132775429 GGCGGCGGCGGCGGCGGCGATGG + Exonic
1049651602 8:143772257-143772279 GCCGCGGGCCGCCGCGCTGAGGG + Intergenic
1049762266 8:144336885-144336907 GGCGACGGCGGCGGCGGCGGCGG + Intergenic
1049788524 8:144462611-144462633 GGCGGGGGCGGCCCGGCCGCGGG - Intronic
1051206375 9:14693315-14693337 GGCCTGGGCGGCGGCGCCGGAGG - Exonic
1055514160 9:77020147-77020169 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1056475174 9:86946298-86946320 GGCGCGGGCGGCCCCGGCGCGGG - Exonic
1056922347 9:90801858-90801880 GGCGAGGGCGGGCGCAGCGCGGG - Exonic
1057361125 9:94374676-94374698 GGCGCCAGCGGCGGCGCCGAGGG - Exonic
1057995727 9:99820531-99820553 GGCGGGGGGCGCTGCGCCGAGGG - Intergenic
1058843664 9:108934459-108934481 GGCGGGGGTGGCGGCGCCGGAGG + Exonic
1060087301 9:120714260-120714282 GGCGACGGCGGCGGCGGCGGCGG + Exonic
1060700750 9:125747378-125747400 GGCGGCGGCGGCGGCGACGAGGG - Intronic
1060832022 9:126722942-126722964 GGCGGGGGCGGGCGCCCCGGGGG - Intergenic
1061438148 9:130579644-130579666 GGCGTCGGCGGCGGCGGCGACGG + Exonic
1062340992 9:136094019-136094041 GGAGAGTGCGGCCGCGCTGGCGG + Intronic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1062696224 9:137877665-137877687 GGCGGGGGCGGCCGCGGGGCGGG + Intergenic
1203363666 Un_KI270442v1:238882-238904 GGGGAGGGTGGCCGCGCTCAAGG + Intergenic
1185482572 X:458795-458817 GCCAAGGGCGGCCGGGCCGGTGG + Intergenic
1185641840 X:1592653-1592675 GGGGTGGGCGGCCGGGCCGGAGG + Intronic
1187067463 X:15854724-15854746 GGCGGCGGCGGCGGCGGCGAAGG + Exonic
1187225829 X:17375104-17375126 GGCGGGGGAGGCCGGGGCGAGGG - Intergenic
1189281235 X:39821302-39821324 GGCGATGGCGGGCGCGCCGGCGG - Intergenic
1189332868 X:40153912-40153934 TGCGAGGGCTGCCGCGCCGTGGG + Intronic
1190337204 X:49269844-49269866 GGCGGCGGCGGCGGCACCGACGG - Exonic
1190714807 X:53094249-53094271 GGCAGGGGCGGCGGCGGCGACGG + Intergenic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1198205413 X:134460426-134460448 GGCTCGGGCGGCCGGGCCCAGGG + Intronic
1199612722 X:149631732-149631754 GGCGGCGGCGGCGGCGGCGACGG - Exonic
1200002596 X:153069704-153069726 GGCGGGGGCGGCCGAGGCGGGGG + Intergenic
1200005128 X:153080306-153080328 GGCGGGGGCGGCCGAGGCGGGGG - Intergenic
1200135777 X:153873911-153873933 GGCCAGGGCGGCCTCGAGGAAGG + Intronic