ID: 1073326155

View in Genome Browser
Species Human (GRCh38)
Location 10:102644857-102644879
Sequence CCTGCACGTGGAGAAGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 397}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073326151_1073326155 2 Left 1073326151 10:102644832-102644854 CCAACATCGTGGAGAAGTTCAAT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1073326155 10:102644857-102644879 CCTGCACGTGGAGAAGCCGCCGG 0: 1
1: 0
2: 2
3: 55
4: 397
1073326149_1073326155 13 Left 1073326149 10:102644821-102644843 CCTGAAGCTCACCAACATCGTGG 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1073326155 10:102644857-102644879 CCTGCACGTGGAGAAGCCGCCGG 0: 1
1: 0
2: 2
3: 55
4: 397
1073326148_1073326155 25 Left 1073326148 10:102644809-102644831 CCTGGAGAAGAACCTGAAGCTCA 0: 1
1: 0
2: 5
3: 38
4: 328
Right 1073326155 10:102644857-102644879 CCTGCACGTGGAGAAGCCGCCGG 0: 1
1: 0
2: 2
3: 55
4: 397
1073326147_1073326155 30 Left 1073326147 10:102644804-102644826 CCGGGCCTGGAGAAGAACCTGAA 0: 1
1: 0
2: 3
3: 21
4: 270
Right 1073326155 10:102644857-102644879 CCTGCACGTGGAGAAGCCGCCGG 0: 1
1: 0
2: 2
3: 55
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073326155 Original CRISPR CCTGCACGTGGAGAAGCCGC CGG Exonic
900193922 1:1364375-1364397 CCTGCAGGTGGAGCCACCGCAGG - Intergenic
900500169 1:3000507-3000529 CCTGCACGTGGAGAAGTGCCGGG - Intergenic
900628594 1:3621723-3621745 CCTGCACCTGGAAAAGCCGTAGG + Intergenic
900645781 1:3708075-3708097 CCTGAGCATGGGGAAGCCGCTGG - Intronic
900744445 1:4351608-4351630 CCTGCATCTGGAGCAGCCCCAGG + Intergenic
903459832 1:23513060-23513082 CCAGCACTTGGAGAGGCCGAGGG - Intronic
903664166 1:24996457-24996479 CCTGCAGGTGGGGAAGCCCTGGG - Intergenic
905406705 1:37738116-37738138 CCAGCACTTGGAGAGGCCGAGGG + Intronic
905417606 1:37815133-37815155 CCTTCACTTGGAGAAGCTGCTGG + Exonic
906183469 1:43841162-43841184 CCTGCACCTGAAAAAGCCTCAGG - Intronic
906991817 1:50747217-50747239 CCTGCACCTGGACAAGCTGGAGG + Intronic
907296762 1:53460539-53460561 CCTGCACGTGGGGAAACGGAGGG - Intronic
908094415 1:60721793-60721815 CATGCACTTGGAAAAGCCACAGG + Intergenic
908616716 1:65930429-65930451 CCTGCACCTGGAAAAGCTACAGG + Intronic
909024103 1:70463278-70463300 CATGCACCTGGAAAAGCTGCAGG + Intergenic
909235890 1:73152464-73152486 CATGCACCTGGAAAAGCTGCAGG - Intergenic
909364039 1:74798964-74798986 CCTGCACCTGGAAAAGCCACAGG - Intergenic
909369779 1:74870414-74870436 CCTGCACCTGGAAAAGCTTCAGG + Intergenic
909503625 1:76362862-76362884 CCTGCACCTGGAAAAGCTGCAGG - Intronic
909532041 1:76692539-76692561 CCTGCACCTGGAAAAGCCACAGG - Intergenic
910588590 1:88904791-88904813 CCAGCACTTGGAGAAACTGCTGG - Intergenic
910706862 1:90139575-90139597 CATGCACTTGGAAAAGCCTCAGG - Intergenic
911009322 1:93262667-93262689 CGTGCACTTGGAAAAGCCCCAGG - Intronic
911009474 1:93263901-93263923 CCTTCACCTGGAAAAGCCTCAGG - Intronic
912809429 1:112782794-112782816 CCTGCACCTGGAAAAACCACAGG - Intergenic
913348611 1:117832683-117832705 CTTGTACCTGGAGAAGCTGCAGG + Intergenic
914193549 1:145431584-145431606 CCCGCATGTGGAGAAATCGCAGG + Intergenic
914398151 1:147290332-147290354 CTTGCACTTGGAGAAGCTGAGGG - Intronic
914474878 1:148014474-148014496 CCCGCATGTGGAGAAATCGCAGG + Intergenic
914857446 1:151362964-151362986 CCTGCACCTGGAAAAGCCACAGG + Intergenic
915470301 1:156121903-156121925 CCAGCACTTTGAGAAGCCGAGGG + Intronic
915855675 1:159383920-159383942 CCTTCACCTGGAAAAGCCACAGG + Intergenic
916790363 1:168120105-168120127 CATGCACCTGGAAAAGCCGCAGG + Intronic
917002439 1:170374812-170374834 CCAGCACCTGGAAAAGCCACAGG - Intergenic
918323023 1:183382856-183382878 CGTGCACTTGGAAAAGCTGCAGG - Intronic
919505821 1:198396642-198396664 CCTGCAGGTGCAGAAGGTGCTGG + Intergenic
919910109 1:202105999-202106021 CAGGGAGGTGGAGAAGCCGCAGG + Intergenic
921013789 1:211168810-211168832 CATGCACCTGGAAAAGCTGCAGG - Intergenic
921621391 1:217329903-217329925 CGTGCACCTGGAAAAGCCACAGG - Intergenic
923139777 1:231151511-231151533 CCTGCACCTGGAAAAGCTCCAGG - Intergenic
923141525 1:231163968-231163990 CAAGCACGAGGTGAAGCCGCTGG + Exonic
1062770451 10:96251-96273 CGTGCACCTGGAAAAGCCACAGG - Intergenic
1063195845 10:3741920-3741942 CCTGCACTTGATGAAGCAGCTGG - Intergenic
1064571905 10:16702384-16702406 CCTGCACCGGGAAAAGCTGCAGG + Intronic
1064604295 10:17022594-17022616 CCTGCAGGCGGAGAAACCGGAGG + Intronic
1065534271 10:26701839-26701861 CGTGCACCTGGAAAAGCTGCAGG + Intronic
1070224129 10:74482930-74482952 CATGCACCTGGAAAAGCTGCAGG - Intronic
1071245272 10:83754662-83754684 CCTGCACCTGGAAAAGCCACAGG + Intergenic
1071328141 10:84536547-84536569 CCTGCAGGTGGAGACTGCGCTGG + Intergenic
1071962802 10:90823193-90823215 CATGCACCTGGAAAAGCTGCAGG + Intronic
1072250373 10:93577520-93577542 CCTGCACTTGAACAAGCCTCAGG - Intronic
1072276992 10:93833373-93833395 CCTGCAACTGGAAAAGCTGCAGG - Intergenic
1072358284 10:94633593-94633615 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1072654714 10:97321569-97321591 CCTCCAAATGGAGAAGCTGCAGG + Exonic
1073326155 10:102644857-102644879 CCTGCACGTGGAGAAGCCGCCGG + Exonic
1073952664 10:108829094-108829116 CTTGCACCTGGAAAAGCCACAGG - Intergenic
1073964936 10:108978189-108978211 CATGCACCTGGAAAAGCCACAGG + Intergenic
1074226495 10:111489278-111489300 CTTGCACCTGGAAAAGCCACAGG + Intergenic
1076598602 10:131642153-131642175 CCTACAGGGGGAGAAGCAGCAGG - Intergenic
1077011031 11:379439-379461 CGTGAACGTGGAGAAGCGCCGGG + Exonic
1077305225 11:1865926-1865948 CCTGCAGGTGGACAAGGCCCGGG - Intronic
1079772071 11:24474889-24474911 TCTGCACCTGGAAAAGCTGCAGG - Intergenic
1079915590 11:26365302-26365324 CCTACACCTGGAAAAGCTGCAGG - Intronic
1079916235 11:26371548-26371570 CATGCACCTGGAAGAGCCGCAGG + Intronic
1081692435 11:45087493-45087515 CCTGCAGCTGGACAAGCAGCAGG - Intergenic
1082118978 11:48357650-48357672 CCGGCACCTGGAAAAGCTGCAGG - Intergenic
1084308906 11:68304583-68304605 CCTGCACCTGGAAAAGCCGCAGG + Intergenic
1085000381 11:73028170-73028192 CATGTACCTGGAAAAGCCGCAGG + Intronic
1085600818 11:77854689-77854711 CATGCACCTGGAAAACCCGCAGG - Intronic
1087474276 11:98617784-98617806 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1089209498 11:116790784-116790806 CCTGCGCGTGCAGGAGCTGCAGG - Exonic
1089820968 11:121225938-121225960 CCTGCACTGGGAAAAGCCACAGG - Intergenic
1091850519 12:3693304-3693326 CTTGCTTGTGGAGCAGCCGCAGG - Intronic
1091927888 12:4370510-4370532 CCTGAACGTGCTGAAGCCCCGGG - Exonic
1092670573 12:10856415-10856437 CATGCACCTGGAAAAGCTGCAGG + Intronic
1093596882 12:20972821-20972843 CATGCACCTGGAAAAGCCACAGG + Intergenic
1095300786 12:40581677-40581699 CATGCACCTGGAAAAGCCACAGG - Intergenic
1095639278 12:44468214-44468236 CCTGCACCTGGAACAGCCACAGG + Intergenic
1096428901 12:51527250-51527272 CCTGCAGGAGGAGAATCCGTTGG - Intergenic
1098644360 12:72880218-72880240 CCTGCACCTGAAAAAGCCACAGG - Intergenic
1099360544 12:81694763-81694785 CCTGTGCCTGGAGAAGCCACAGG + Intronic
1099487800 12:83249655-83249677 CATGCACCTGGAAAAGCCACAGG + Intergenic
1099658728 12:85527924-85527946 TCTGCACTTGGAAAAGCCACAGG + Intergenic
1099724824 12:86412290-86412312 CATGCACCTGGAAAAGCTGCAGG + Intronic
1100230278 12:92600065-92600087 CATGCACCTGGAAAAGCCACAGG - Intergenic
1101516315 12:105438823-105438845 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1102197591 12:111035679-111035701 CCAGGACGGGGAGAAGGCGCGGG - Intronic
1102677022 12:114665881-114665903 ACTGCAGGTGGAGACGCCGCAGG - Intergenic
1103264630 12:119618443-119618465 CATGCACCTGGAAAAGCCACAGG + Intronic
1103703900 12:122861316-122861338 CCTGGAGCTGGAGAAGACGCTGG + Exonic
1103994026 12:124817578-124817600 CCTGAAGGGCGAGAAGCCGCAGG - Exonic
1104174434 12:126316305-126316327 CCTGCACGGGGAGAAGTCAGCGG - Intergenic
1104199974 12:126579055-126579077 CCTGCAGGTGCAGATGCTGCAGG + Intergenic
1104357266 12:128098918-128098940 GCAGCACGTGGACAAGCCGTGGG - Intergenic
1105321156 13:19323684-19323706 CCTTCACCTGGAAAAGCCACAGG - Intergenic
1105528857 13:21200313-21200335 CCTGCACATGGAAAAGTGGCAGG - Intergenic
1105604048 13:21912017-21912039 CCTGCATGGGGAGAAGGTGCTGG + Intergenic
1106338901 13:28809583-28809605 CCCGCACCTGGAAAAGCCACAGG + Intergenic
1106340207 13:28820131-28820153 CCTGGACAAAGAGAAGCCGCGGG - Intergenic
1107960107 13:45549841-45549863 CCTGCCCATGGAGAAGCAGCTGG - Intronic
1107972242 13:45654771-45654793 CCTTAACGTGGAAAAGCTGCAGG - Intergenic
1108893631 13:55294950-55294972 CCTGCACCTGGAAAAGCTACAGG + Intergenic
1108981774 13:56523458-56523480 CATGCACCTGGAAAAGCCACAGG - Intergenic
1110033887 13:70654417-70654439 CCTGCACCTGGAAAAGCCACAGG + Intergenic
1110874384 13:80490841-80490863 CCTGCACTGGGAGCAGCCGGCGG - Intergenic
1110955301 13:81546316-81546338 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1111065788 13:83089505-83089527 CATGCACCTGGAAAAGCCACAGG + Intergenic
1111463377 13:88575811-88575833 CCTGCACCTGGAAAAGCCACAGG - Intergenic
1111778680 13:92694343-92694365 CATGCACCTGGAAAAGCCTCAGG + Intronic
1112812463 13:103234287-103234309 CATGCACCTGGAAAAGCCACAGG + Intergenic
1113061081 13:106323249-106323271 CCTGCACATGGAAAAGCCGGAGG + Intergenic
1113444441 13:110354925-110354947 CCTCCACGTGGACATGCAGCTGG + Intronic
1114689091 14:24563639-24563661 CCTGCACTTGAAAAAGCCACAGG + Intergenic
1115592041 14:34874317-34874339 CCTCCACCTGGAGAACGCGCGGG - Intronic
1115989973 14:39141402-39141424 CATGCACCTGGAAAAGCCACAGG - Intergenic
1116485557 14:45444287-45444309 CATGCACCTGGAAAAGCCACAGG + Intergenic
1116526789 14:45916020-45916042 CCTGCACTTGGAAAAGCTACAGG - Intergenic
1116696443 14:48183595-48183617 CATGCACCTGGAAAAGCCACAGG + Intergenic
1116780904 14:49236558-49236580 CGTGCACCTGGAAAAGCCACAGG + Intergenic
1117209512 14:53481229-53481251 CCTGCACCTGGAAAAGCTGTAGG - Intergenic
1117984510 14:61374294-61374316 CTTGCACCTGGAAAAGCCACAGG - Intronic
1119759212 14:77139708-77139730 CCACCACGTTGAGCAGCCGCAGG + Exonic
1119769813 14:77213522-77213544 CCTGCAGGTGGAGAGGCCCGGGG - Intronic
1121237898 14:92406305-92406327 CGTGCACCTGGAAAAGCCACAGG - Intronic
1121369268 14:93341978-93342000 CATGCACCTGGAAAAGCCACAGG - Intronic
1121384736 14:93509765-93509787 CATGCACCTGGAAAAGCTGCGGG - Intronic
1121819071 14:96951366-96951388 CCTGCAAGAGGAGAAGGAGCTGG + Intergenic
1124445023 15:29722719-29722741 CATGCACCTGGAAAAGCCACAGG + Intronic
1124566196 15:30816569-30816591 CGTGCACGTTCGGAAGCCGCAGG + Intergenic
1124705534 15:31960745-31960767 CTTGCACCTGGAAAAGCCACAGG + Intergenic
1126490616 15:49231916-49231938 CATGCACATGTAAAAGCCGCAGG - Intronic
1128149887 15:65356038-65356060 TCTGCAGGTGGAGAAGGCTCGGG - Intronic
1128579474 15:68798759-68798781 GCTGCAAGTGGAGAAGAGGCAGG + Intronic
1128844037 15:70873656-70873678 ACTCCATGTGGAGAAGCAGCTGG - Intronic
1129376845 15:75138899-75138921 CCTGCACCAGGAGCAGCCTCGGG + Intergenic
1129812738 15:78523985-78524007 CCTGCCCCTGGAAAAGCCACAGG - Intronic
1130226248 15:82060288-82060310 CCTGTGCTTGGAGAAGCCCCTGG - Intergenic
1131418316 15:92280252-92280274 CCTCCACATGGAGAATCAGCAGG + Intergenic
1133196449 16:4174223-4174245 CCTGCACTTTGAGAGGCCGAGGG + Intergenic
1133964042 16:10518619-10518641 TCAGCACGTGGAGCAGCTGCTGG - Intergenic
1134234926 16:12458155-12458177 ACTGCACGTGGAGAAACCTCAGG + Intronic
1135660000 16:24287857-24287879 CCAGCACTTGGAGAGGCCGAGGG + Intronic
1136642420 16:31578038-31578060 CCTGCACCTGGAAAAACCGCAGG + Intergenic
1136663212 16:31783658-31783680 CCTACACCTGGAAAAGCCACAGG - Intronic
1137549585 16:49428035-49428057 CCTGCTCTTGGAGAAGCCAGTGG + Intergenic
1137638603 16:50009026-50009048 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1137729755 16:50680790-50680812 CCTGCTCTTGGACAAGCCCCTGG - Intronic
1139083863 16:63560929-63560951 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1141553872 16:84824178-84824200 CCTGCAGGTGGAGAAGGGCCTGG + Intronic
1144196061 17:12896400-12896422 TCTGCAGGTGGAGAAGCGTCTGG + Exonic
1144676317 17:17164483-17164505 CCTGCTGCTGGAGAAGACGCAGG + Intronic
1145214307 17:21041130-21041152 CCAGCACGTGGGGAGGCCGAGGG - Intronic
1146183797 17:30712234-30712256 CGTGCAGGTGGAGACGCCACCGG - Intergenic
1147910639 17:43853938-43853960 CCTGCAGGAGGAGAGGTCGCTGG - Exonic
1148073716 17:44923253-44923275 CCTGCAAGTGCAGAGGCAGCAGG - Intergenic
1148800952 17:50225460-50225482 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1149494727 17:57110003-57110025 CCTGCAGGGGAAGAAGCAGCAGG - Exonic
1151479097 17:74359902-74359924 CCTGTAGGTGGAGGAGCCGGGGG + Intronic
1151783886 17:76265775-76265797 TCTGCACGTGGGGCAGCCGAGGG + Intronic
1152794673 17:82301234-82301256 CCCGGACGTGGAGAAGCCTCAGG + Intergenic
1153108025 18:1550356-1550378 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1153907096 18:9671427-9671449 CCAGAACTTGGAGAAGCTGCAGG - Intergenic
1156251064 18:35352883-35352905 CCTGCACTTGGAAAAGCCACAGG + Intergenic
1156417153 18:36908587-36908609 CCAGCACGTTGAGAGGCCGAAGG - Intronic
1156736288 18:40263463-40263485 CCTACACCTGGAAAAGCTGCAGG + Intergenic
1159152093 18:64534191-64534213 CATGCACCTGGAAAAGCCACGGG + Intergenic
1159218528 18:65428758-65428780 CCTGTACCTGGAAAAGCTGCAGG + Intergenic
1159892274 18:73964134-73964156 CATGCACCTGGAAAAGCCACAGG - Intergenic
1160507205 18:79433916-79433938 CCTGCACGTGTGGAAGCAGGAGG - Intronic
1160530352 18:79558880-79558902 CCTGGACGTGGAGAAGGAGGAGG - Intergenic
1160716561 19:579404-579426 CCTTCCCGGGGAGGAGCCGCAGG + Intronic
1160817867 19:1044573-1044595 CCTGCATCTGCAGGAGCCGCTGG - Exonic
1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG + Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1167492851 19:49802041-49802063 CCTGCTCCTGCAGAAGCCGGGGG - Exonic
925235376 2:2272973-2272995 ACTGCAGGTGGAGAAGGAGCTGG - Intronic
925347055 2:3178811-3178833 CCTGCACGTGGAGGAAGAGCCGG - Intergenic
925489398 2:4375353-4375375 CCTGCACCTGGAAAAGCCACAGG - Intergenic
926099533 2:10105498-10105520 CATGCACCTGGAAAAGCCACAGG - Intergenic
926461147 2:13130856-13130878 CATGCACCTGGAAAAGCCACAGG + Intergenic
927033727 2:19150460-19150482 CTTGCACCTGGAAAAGCCACAGG - Intergenic
928797571 2:35040592-35040614 CATGCACTTGGAAAAGCCACAGG + Intergenic
929143555 2:38687156-38687178 CCAGCACCTGGAGATGCCCCTGG - Intronic
930006824 2:46904383-46904405 CGTGCACCTGGAAAAGCCGCAGG + Exonic
930119522 2:47748585-47748607 CCTGCACTTGGAAAAGCTGCAGG + Intronic
930305336 2:49668332-49668354 CCTGCATCTGGAAAAGCCACAGG - Intergenic
930812960 2:55561497-55561519 CATGCACCTGGAAAAGCCACAGG + Intronic
930931289 2:56886414-56886436 CCTGTGCCTGGAGAAGCCACAGG + Intergenic
930961434 2:57266876-57266898 CGTGCACCTGGAAAAGCTGCAGG - Intergenic
931154152 2:59608467-59608489 CATGCACCTGGAAAAGCCACAGG + Intergenic
931485793 2:62690312-62690334 CCTGCACTTTGAGAGGCCGAGGG + Intronic
934891884 2:98077946-98077968 CCTGCACCTGGAAAAGCCATAGG - Intergenic
935746608 2:106194440-106194462 CCTGCGGGTAGAGAAGCCGGAGG - Intergenic
936730281 2:115374442-115374464 CATGCACCTGGAAAAGCCACAGG - Intronic
936753750 2:115678725-115678747 CGTGCACCTGGAAAAGCTGCAGG + Intronic
937726771 2:125176047-125176069 ACTGCACCTGGAAAAGCTGCAGG + Intergenic
937995383 2:127690454-127690476 CCTGCACCTGGAAAAGCCACAGG - Intergenic
938718125 2:134039626-134039648 CATGCACCTGGAAAAGCCTCAGG - Intergenic
939241973 2:139572893-139572915 CCTGAACCTGGAAAAGCCTCAGG + Intergenic
939677291 2:145088301-145088323 ACTGCACGTGCAGAAGCCCAGGG + Intergenic
939852982 2:147321701-147321723 CATGCACCTGGAAAAGCCACAGG + Intergenic
940598031 2:155819519-155819541 CATGCACCTGGAAAAGCTGCAGG + Intergenic
943603051 2:189943641-189943663 CCTGAACCTGGAAAAGCTGCAGG + Intronic
945410204 2:209498384-209498406 CCTGCACCTGGAAAAGCCACAGG - Intronic
946805090 2:223463630-223463652 CCTGCACCTGGACAAGCCTCAGG + Intergenic
946930074 2:224662424-224662446 CATGCACCTGGAAAAGCCACAGG - Intergenic
947488142 2:230571238-230571260 CGTGCACATGGAGAAACCACAGG - Intergenic
947741007 2:232484986-232485008 CCTGCAAGTGGAGCAGCAGCTGG - Exonic
948292374 2:236835352-236835374 CATGCACCTGGAAAAGCTGCAGG - Intergenic
948424270 2:237877627-237877649 CCTGCCCTTGGAGAGGCCGCGGG - Intronic
948430080 2:237913219-237913241 CCTGTGAGTGGAGAAGCCGAGGG + Intergenic
948560822 2:238849649-238849671 CCTGCGCGAGGAGAAGGCTCGGG + Intronic
948808290 2:240462333-240462355 CCTGCACCTGGAGGAGACGCTGG + Exonic
948928861 2:241117429-241117451 CCTGCAGCTGGACAGGCCGCAGG - Intronic
1170597214 20:17815102-17815124 CCTGCAGGAGGAGGAGCCGGGGG + Intergenic
1170845886 20:19961599-19961621 CCTGCATTTGGAGAAGCTGAAGG + Intronic
1170938598 20:20830322-20830344 CATGCACCTGGAAAAGCCACAGG + Intergenic
1172603750 20:36200912-36200934 CCTGAGCCTGGAGCAGCCGCAGG + Intronic
1172893138 20:38281291-38281313 CATGCACATGGAAAAGCCACAGG - Intronic
1173091227 20:39974442-39974464 CCTGCACTGGGAGATGCCACAGG + Intergenic
1175203011 20:57290883-57290905 CCTGGACCTGGAGAAGCTGTAGG - Intergenic
1175405048 20:58720350-58720372 CCAGCAGGTGCAGAAGCCCCAGG + Intergenic
1175764834 20:61585048-61585070 CATGCAGGTGGAGAAGCGGAGGG - Intronic
1177188601 21:17824669-17824691 CTTGCACCTGGAAAAGCCGTAGG - Intergenic
1177268061 21:18809775-18809797 CCTGCACCTGGAAAAGCCATGGG - Intergenic
1177288335 21:19079071-19079093 TCTGCACCTGGAAAAGCCACAGG + Intergenic
1177767385 21:25474021-25474043 CATGCACCTGGAAAAGCCACAGG + Intergenic
1178029232 21:28505515-28505537 CCTGCACCTGGAAAAGCCACAGG - Intergenic
1178181068 21:30162193-30162215 CATGCACATGGACAAGCAGCTGG - Intergenic
1178992497 21:37367280-37367302 CCTCCTCGGGAAGAAGCCGCCGG + Intronic
1179381155 21:40900632-40900654 CTTGCTCGTGGAGATGCCTCTGG + Intergenic
1179884554 21:44308041-44308063 AGTGCACATGGAGAAGCCGAGGG + Intronic
1180963971 22:19776133-19776155 CCTGTCCCTGGGGAAGCCGCTGG - Intronic
1181358382 22:22316312-22316334 CCTACACCTGGAAAAGCTGCAGG - Intergenic
1182120792 22:27785362-27785384 GCCGGACGTGGAGAAGCGGCCGG - Intronic
1183004545 22:34890276-34890298 CATGCACCTGGAAAAGCCACAGG + Intergenic
1183716589 22:39536831-39536853 CCTGCACGTGGAGCAGCTCCTGG - Intergenic
1183884517 22:40866997-40867019 CGTGCATGTGGAGAAGGTGCAGG + Intronic
1184258466 22:43300911-43300933 CCTGCACGTGGACATCCTGCGGG + Intronic
1184800439 22:46755678-46755700 CCTACACCTGGAGAAGCTGCAGG - Intergenic
950776132 3:15352010-15352032 CCTGTACCTGGAAAAGCCACAGG + Intergenic
951384957 3:22031147-22031169 CTTGCACTTGGAAAAGCTGCAGG - Intronic
951430197 3:22597546-22597568 CATGCACCTGGAAAAGCCACAGG + Intergenic
952139197 3:30459371-30459393 CCTGCACCTGGAAAAGCCATAGG + Intergenic
954305352 3:49722664-49722686 CCGGTTCGTGGAGAAGCCACAGG - Exonic
954636341 3:52072904-52072926 CCTCCCCGTGGAGATGCTGCAGG - Intergenic
955167327 3:56527306-56527328 CCTGCACCTGGAAAAGCCACTGG + Intergenic
957087812 3:75698870-75698892 CCTGCACCTGGAAAAGCCAGAGG + Intergenic
957113217 3:75992701-75992723 CATGCACCTGGAAAAGCCACAGG + Intronic
957281245 3:78154142-78154164 CCTGCAAGTGTAGGAGTCGCGGG + Intergenic
957490629 3:80921921-80921943 CCTGCACCTGGAAAAGCCGCAGG + Intergenic
957576530 3:82015057-82015079 CCTGCACCTGGAAAAGCCACAGG + Intergenic
957909543 3:86603922-86603944 TGTGCACCTGGAGAAGCCACAGG + Intergenic
957981778 3:87519897-87519919 CATGCACTTGGAAAAGCAGCAGG + Intergenic
958256597 3:91332331-91332353 CCTGCACCTGGAAAAGACACAGG + Intergenic
958528426 3:95292189-95292211 CCTGCACCTGGAAAAGCCACAGG + Intergenic
958837171 3:99159033-99159055 CCTGCACCTGGAAAAGCCATAGG - Intergenic
959342495 3:105148964-105148986 CATGCACCTGGAAAAGCCACAGG - Intergenic
959769244 3:110072651-110072673 CCTGCACCTGGAAAAGCTACAGG + Intergenic
959814806 3:110662737-110662759 TGTGCACCTGGAAAAGCCGCAGG + Intergenic
960479528 3:118171480-118171502 CCCGCACTTGGAGCAGCCGGCGG + Intergenic
960842983 3:121978918-121978940 CATGCACCTGGAAAAGCCACAGG + Intergenic
961067587 3:123889649-123889671 CATGCACCTGGAAAAGCTGCAGG - Intergenic
964076637 3:152700541-152700563 CGTGCACCTGGAAAAGCCACAGG - Intergenic
964279825 3:155052211-155052233 TCTGCACCTGGAAAAGCCACAGG - Intronic
964545385 3:157828441-157828463 CATGCACTTGGAAAAGCCACAGG - Intergenic
965232438 3:166071307-166071329 CCTGCACCTGAAAAAGCCACAGG - Intergenic
965990457 3:174811288-174811310 CTTGCACCTGGAAAAGCCACAGG + Intronic
966500745 3:180635755-180635777 CATGCACCTTGAAAAGCCGCAGG - Intronic
966902857 3:184499699-184499721 CCTGCAGGTGGAGAACCCCATGG - Intronic
966945322 3:184773656-184773678 CCTGCCCGTGGAACTGCCGCTGG + Intergenic
967210058 3:187160325-187160347 CCTGCACGTGGTGGATCAGCTGG - Intronic
967592365 3:191293846-191293868 CCAGCACTTTGAGAAGCCGGGGG + Intronic
967633936 3:191778701-191778723 CGTGCACCTGGAAAAGCCACAGG + Intergenic
968502961 4:959706-959728 CATGCACGTGGAGGAGGAGCTGG - Exonic
970659173 4:18264917-18264939 CATGCACCTGGAAAAGCCACAGG - Intergenic
970715236 4:18913712-18913734 CGTGCACCTGGAAAAGCCACAGG + Intergenic
970817904 4:20179302-20179324 CCTGCACTTGGAGCAGCCAGTGG - Intergenic
971170119 4:24225318-24225340 CCTGCACTTTGAGAAGCCAAGGG + Intergenic
971858880 4:32079143-32079165 CCTGCACCTGGAAAAGCTACAGG - Intergenic
971889906 4:32507074-32507096 TCTGCACCTGGAAAAGCCTCAGG + Intergenic
973614282 4:52663435-52663457 TCTGCACCTGGAAAAGCCACAGG + Intergenic
974638059 4:64590908-64590930 CCTGCACCTGGAAAAGCCACAGG - Intergenic
974651175 4:64755527-64755549 CCTGCACCTGGAAAAGCCATAGG + Intergenic
976782492 4:88776723-88776745 CCAGCACTTTGAGAAGCCGAGGG + Intronic
977499480 4:97821414-97821436 CCTGCACCTGGAAAAGCTGCAGG - Intronic
977942852 4:102877508-102877530 CATGCATCTGGAAAAGCCGCAGG - Intronic
978083359 4:104621133-104621155 CATGCACCTGGAAAAGCCACAGG - Intergenic
978344908 4:107756757-107756779 CATGCACCTGGAAAAGCCACTGG + Intergenic
980324519 4:131324318-131324340 CGTGCACCTGGAGAAGCTGTAGG + Intergenic
980458579 4:133076127-133076149 CATGCACCTGGAAAAGCTGCAGG - Intergenic
982390872 4:154862705-154862727 CCTTCACATGGAAAAGCCACAGG - Intergenic
982504892 4:156205314-156205336 CATGCACCTGGAAAAGCTGCAGG - Intergenic
982520956 4:156416446-156416468 CGTGCACCTGGAAAAGCTGCAGG - Intergenic
982597368 4:157403846-157403868 CATGCACCTGGAAAAGCTGCAGG - Intergenic
982678961 4:158407402-158407424 CCTGGACTTGGAGAAGCTGGAGG + Intronic
982797480 4:159663552-159663574 CATGCACCTGGAAAAGCCACAGG - Intergenic
983039345 4:162906581-162906603 CCTGCACCTGGAAAAGTGGCAGG + Intergenic
983351526 4:166596788-166596810 CCTGCACCTGGAAAAGCAACAGG + Intergenic
983419197 4:167496201-167496223 CATGCACCTGGAAAAGCCACAGG - Intergenic
985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG + Intergenic
987542836 5:19277196-19277218 CCTGCACCTGGAAAAGTCACAGG + Intergenic
989229024 5:39065909-39065931 CCTATACCTGGAGAAGCCACAGG - Intronic
990077873 5:51873385-51873407 CATGCACCTGGAAAAGCTGCAGG + Intergenic
990939655 5:61188844-61188866 CATGCACCTGGAAAAGCCACAGG + Intergenic
991355705 5:65767035-65767057 CCTGCACCTGAAAAAGCTGCAGG - Intronic
991549169 5:67817761-67817783 CCTCAGCGTGGAGAAGCTGCAGG + Intergenic
991869700 5:71097973-71097995 CCTGCACTTGGAAAAGCCACAGG + Intergenic
993752826 5:91691810-91691832 CATGTACCTGGAAAAGCCGCAGG - Intergenic
993777039 5:92012462-92012484 CGTGCACCTGGAAAAGCCACAGG + Intergenic
994439933 5:99789671-99789693 CATGCACCTGGAAAAGCCACAGG - Intergenic
994781462 5:104095322-104095344 CCTGCACCTGAAAAAGCCACAGG - Intergenic
994925669 5:106114584-106114606 CCTGCATGTGGAAAAGCTTCAGG + Intergenic
995703548 5:114961778-114961800 CATGCACCTGGAAAAGCTGCAGG - Intergenic
996235860 5:121128362-121128384 CATGCACCTGGAAAAGCCTCAGG + Intergenic
996453666 5:123656030-123656052 CGTGCACCTGGAAAAGCCACAGG - Intergenic
997100049 5:130958620-130958642 CATGCATGTGGAAAAGCCTCAGG + Intergenic
998278666 5:140783436-140783458 CCTGAGCCTGGAGAAGCTGCAGG + Intergenic
998380881 5:141724551-141724573 CCTGTACCTGGAAAAGCCACGGG - Intergenic
998394708 5:141811387-141811409 CCTGCGCATGGAGAAGAGGCTGG - Intergenic
998487742 5:142517627-142517649 CGTGCACCTGGAAAAGCTGCAGG + Intergenic
998745890 5:145259353-145259375 CCTGCACCTGGAAAAGCCACAGG + Intergenic
999478158 5:151920880-151920902 CCTGGAGATGGAGAAGCCACAGG + Intronic
1002711115 5:181195514-181195536 CCGGCCCGAGGAGAAGCCGCAGG + Exonic
1003403107 6:5807058-5807080 CCTGCACATGGAAAAGTGGCAGG + Intergenic
1005674499 6:28140244-28140266 CCAGCACTTTGTGAAGCCGCGGG - Intergenic
1007361580 6:41360517-41360539 CTTGCACCTGGAAAAGCCACAGG + Intergenic
1008998744 6:57688829-57688851 CCTGCACCTGGAAAAGACACAGG - Intergenic
1009187228 6:60588208-60588230 CCTGCACCTGGAAAAGACACAGG - Intergenic
1009680075 6:66880864-66880886 CTTGCACTTGGAAAAGCCACAGG - Intergenic
1010001863 6:70956593-70956615 CCTGGGCGTGGAGGAGCGGCAGG + Exonic
1010430243 6:75769931-75769953 CCTGAACCTGGAAAAGCCACAGG - Intronic
1010674079 6:78720956-78720978 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1011504615 6:88028145-88028167 CCTGCACCTGGAAAAGCCCCAGG - Intergenic
1011555715 6:88569950-88569972 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1011684647 6:89814726-89814748 CCAGCACCAGGAGCAGCCGCTGG + Intronic
1011981647 6:93386510-93386532 CGTGCACCTGGAAAAGCCACAGG - Intronic
1012120889 6:95365699-95365721 CCTGCATCTGGAAAAGCCACAGG - Intergenic
1012751440 6:103168363-103168385 CATGCACCTGGAAAAGCCACAGG + Intergenic
1012765622 6:103363431-103363453 CGTGCACCTGGAAAAGCTGCAGG + Intergenic
1012823915 6:104123961-104123983 CATGCACCTGGAAAAGCCACAGG + Intergenic
1013474514 6:110495165-110495187 CCTGCACGCAGAGAAGATGCAGG - Intergenic
1014613069 6:123568298-123568320 CCTGCACCTAGAAAAGCTGCAGG - Intronic
1014661731 6:124180833-124180855 CATGCACCTGGAAAAGCCACAGG - Intronic
1014668746 6:124272700-124272722 CATGCACCTGGAAAAGCCACAGG + Intronic
1014933823 6:127364123-127364145 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1015637027 6:135287179-135287201 CCTGCACGTGCAGAAGATGTAGG + Intronic
1016858935 6:148698321-148698343 CCCGCACTTGGAGCAGCCGGTGG - Intergenic
1018051431 6:160012430-160012452 TCTGCATCTGGAGAAGCCTCAGG + Intronic
1018662555 6:166101827-166101849 CCTGCACCAGGAAAAGCTGCAGG - Intergenic
1019446293 7:1073361-1073383 CCTGCGCGGGGAGTAGCTGCCGG - Intronic
1019588189 7:1815880-1815902 TCTGCACGTGGAGAGGGTGCTGG + Exonic
1019876041 7:3811704-3811726 CCTGGCCGTGCAGAAGCCCCCGG + Intronic
1020775684 7:12451106-12451128 CCTGCCCCTGGAAAAGCCACAGG + Intergenic
1022375289 7:29806657-29806679 CCTGCAGGTGGCGGAGCCGGGGG - Exonic
1022414078 7:30163423-30163445 CCTGCTCGTGGTGCAGCAGCGGG + Intergenic
1022607899 7:31834440-31834462 GCTGCACCTGGAAAAGCCACAGG + Intronic
1023275714 7:38516719-38516741 CCTGCACCTGCAAAAGCTGCAGG + Intronic
1023391449 7:39715075-39715097 CCTGCACTTGGAAAAGCCACAGG + Intergenic
1024222565 7:47299928-47299950 CCTGCATCTGGAGAAGCATCTGG + Intronic
1024721145 7:52138825-52138847 CATGCACCTGGAAAAGCCACAGG - Intergenic
1024754943 7:52518576-52518598 CCTGCACCTGGAAAAGCCATAGG - Intergenic
1024860577 7:53835316-53835338 TCTGCACCTGGAAAAGCTGCAGG + Intergenic
1025007134 7:55363582-55363604 GCAGCACCTGGGGAAGCCGCCGG - Intergenic
1025176043 7:56802985-56803007 GCTGCACCTGGAGAGGCCGTGGG + Intergenic
1026955320 7:74372979-74373001 CCTGCTACTGGAGAAGGCGCAGG + Exonic
1027586636 7:80066377-80066399 CCTGCACCTGGAAAAGCTACAGG - Intergenic
1028207276 7:88032192-88032214 CATGCACCTGGAAAAGCTGCAGG + Intronic
1030108448 7:106006746-106006768 CATGCACCTGGAAAAGCCACAGG - Intronic
1031732912 7:125320224-125320246 CCTGCACCTGGAAAAGCCTCAGG + Intergenic
1031914076 7:127546086-127546108 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1032124917 7:129186812-129186834 TCTGCTCCTGGAGAAGCCTCAGG + Intergenic
1033784876 7:144718168-144718190 CCTGCACCTGGAAAAGCTGCAGG + Intronic
1034846550 7:154451503-154451525 CCTGTGCGTGGAGAAGACGCAGG - Intronic
1034927517 7:155134128-155134150 CCAGCACTTTGAGAAGCCGAGGG - Intergenic
1035195564 7:157217585-157217607 CCAGCACTTGGGGAAGCCGACGG + Intronic
1035352790 7:158258285-158258307 GCTGCACGTGGAGATGCCGGGGG - Intronic
1036258302 8:7221947-7221969 CCTGCACCTGGAGAAGAGGAAGG + Intergenic
1036310354 8:7680543-7680565 CCTGCACCTGGAGAAGAGGAAGG + Intergenic
1036359183 8:8065560-8065582 CCTGCACCTGGAGAAGAGGAAGG - Intergenic
1036891775 8:12601392-12601414 CCTGCACCTGGAGAAGAGGAAGG + Intergenic
1037364089 8:18104062-18104084 CCTGCACCTGGAAAATCCACAGG + Intergenic
1037415863 8:18649181-18649203 CCTGCACCTGGAAAAGCCATAGG + Intronic
1037822915 8:22143877-22143899 TCTGGACGTGGACAAGCCCCAGG + Intergenic
1038483768 8:27919301-27919323 CCTGCAGGTGCAGGAGCCTCTGG + Intronic
1039657236 8:39423226-39423248 CATGCACCTGGAAAAGCCACAGG - Intergenic
1040091235 8:43400970-43400992 CATGCACCTGGAAAAGCCACAGG - Intergenic
1041430715 8:57778007-57778029 CCTGCACCTGGAAAAGCCACAGG + Intergenic
1041792544 8:61714007-61714029 CCTGCAGGTGAAGGAACCGCTGG + Intronic
1041988615 8:63956742-63956764 CCTGCAAGTGGACATGCCCCAGG + Intergenic
1043566849 8:81558500-81558522 CCTTCACGTGGAGCAGGCTCAGG - Intergenic
1044051866 8:87515460-87515482 CATGCACCTGGAAAAGCCACAGG + Intronic
1044295193 8:90519135-90519157 TGTGCACGTGGAAAAGCTGCAGG + Intergenic
1045436960 8:102173411-102173433 TCTGCACCTGGAAAAGCTGCAGG - Intergenic
1045438876 8:102190592-102190614 TCTGCACCTGGAAAAGCCACAGG - Intergenic
1045597526 8:103673213-103673235 CCTGCATGTGGAAAAGCTGCAGG - Intronic
1046267185 8:111846289-111846311 CCTTCACCTGGAAAAGCCACAGG - Intergenic
1046668807 8:117035513-117035535 CCTGCACCTGGAAAAGCTTCAGG - Intronic
1046889003 8:119400772-119400794 CCTGCATCTGGAAAAGCCACAGG + Intergenic
1047417068 8:124673421-124673443 CCTGCACGTGGAGTAAAAGCTGG + Intronic
1047923342 8:129657524-129657546 CATGCACCTGGAAAAGCCACAGG - Intergenic
1048180377 8:132189074-132189096 CCTGGATGTGGGGAAGCAGCGGG - Intronic
1048526288 8:135205964-135205986 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1049164300 8:141116942-141116964 CCTGCAGGTGGGGATGCCACAGG - Intergenic
1049589241 8:143448653-143448675 CATGCACCTGGAAAAGCTGCAGG - Intronic
1049807479 8:144547519-144547541 CCTGCTTGTGGAGCAGCCCCTGG - Exonic
1050288684 9:4130871-4130893 CCTGCACCTGGAAAAGCCACAGG + Intronic
1050819090 9:9855648-9855670 CCTGCAGGTGCGGAAGCGGCTGG - Intronic
1053361247 9:37488095-37488117 CCTGCACGTGTAGACGTTGCTGG + Intronic
1055282044 9:74685501-74685523 CTTGCACGGGGAGAAGCTGCAGG + Exonic
1055728906 9:79260761-79260783 CCAGCACTTGAAGAAGCTGCAGG + Intergenic
1056192647 9:84199275-84199297 CCTGCACCTGGAAAAGCTGCAGG - Intergenic
1057285297 9:93748854-93748876 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1057922010 9:99105235-99105257 CCAGCACGAGGAGGAGCAGCCGG - Exonic
1060019612 9:120117762-120117784 CCTGCACCTGGAAAAGCCACAGG + Intergenic
1060321022 9:122561652-122561674 CCTGCACCTGGAGATGTCACTGG + Intergenic
1060965913 9:127712220-127712242 CCTGCAGCTGGAGCAGCAGCAGG + Exonic
1061043911 9:128154177-128154199 CTTGCACGGGGAGAAGGGGCTGG - Intergenic
1061891773 9:133625468-133625490 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1062672451 9:137719493-137719515 CCTGGGAGTGGAGAAGCCCCAGG - Intronic
1185596739 X:1311688-1311710 CCAGCACGTGGAGACGCCAAGGG - Intergenic
1185629777 X:1507627-1507649 CCGGCACGTGGGGACTCCGCCGG - Intronic
1186742659 X:12534472-12534494 CATGCACCTGGAAAAGCTGCAGG + Intronic
1188166459 X:26870256-26870278 CCTACACCTGGAAAAGCCACAGG - Intergenic
1191982427 X:66941117-66941139 TGTGCACGTGGAAAAGCCACAGG + Intergenic
1192474827 X:71431310-71431332 CCAGCACTTTGAGAAGCCGAGGG - Intronic
1192923148 X:75729122-75729144 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1193068362 X:77281346-77281368 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1193406477 X:81107669-81107691 CCTGCACCTGGAAAAGCCCCAGG + Intergenic
1193801944 X:85946820-85946842 CCTGCACCTGAAAAAGCCACAGG + Intronic
1193850536 X:86531825-86531847 CATGAACCTGGAAAAGCCGCAGG + Intronic
1193995949 X:88366075-88366097 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1194064222 X:89241853-89241875 CATGCACCTGGAAAAGCCACAGG + Intergenic
1194150776 X:90323228-90323250 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1194199863 X:90941385-90941407 CATGCACCTGGAAAAGCCGCAGG - Intergenic
1194418144 X:93638232-93638254 CGTGCACCTGGAAAAGCTGCAGG + Intergenic
1194590845 X:95798021-95798043 CCTTCACCTGGAAAAGCCACAGG + Intergenic
1194597910 X:95881852-95881874 CCAGCACTTGGAGAAGCCAAAGG - Intergenic
1194943550 X:100041533-100041555 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1195116879 X:101707882-101707904 CCTGCACTGGGAGAAGCTGTGGG + Intergenic
1195608311 X:106834929-106834951 CTTGCACTTGGAAAAGCTGCAGG - Intronic
1195716044 X:107819531-107819553 CCTGTTCCTGGAAAAGCCGCAGG + Intergenic
1195822127 X:108956818-108956840 CTTGCACCTGGAAAAGCCACGGG + Intergenic
1197719215 X:129733543-129733565 CCTGCACCTGGAAAAGCCACAGG + Intergenic
1198304604 X:135368297-135368319 CATGCACCTGGAAAAGCCTCAGG - Intergenic
1198629221 X:138616525-138616547 CATGCACCTGGAAAAGCCACTGG - Intergenic
1199119126 X:144029906-144029928 CATGCACATGGAAAAGCCCCAGG + Intergenic
1199189278 X:144951544-144951566 CCTGCTCCTGGAAAAGCCACAGG - Intergenic
1199220500 X:145310917-145310939 CATGCACCTGGAAAAGCCACAGG - Intergenic
1199289544 X:146090603-146090625 CCTGTACCTGGAAAAGCCACAGG + Intergenic
1199909692 X:152272173-152272195 CATGCACGTGGAAAAGCTGCAGG + Intronic
1200497145 Y:3899989-3900011 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1200545854 Y:4517801-4517823 CATGCACCTGGAAAAGCCGCAGG - Intergenic
1200718395 Y:6575952-6575974 CATGCACCTGGAAAAGCCACAGG + Intergenic
1201065356 Y:10090736-10090758 CCTGCACGTGGTCTGGCCGCAGG - Intergenic