ID: 1073327145

View in Genome Browser
Species Human (GRCh38)
Location 10:102649664-102649686
Sequence AGCCCGGCAGACCCCAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073327145_1073327152 23 Left 1073327145 10:102649664-102649686 CCCTCTCTGGGGTCTGCCGGGCT 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1073327152 10:102649710-102649732 CCTTGCCCTGGCGCCTGCCCTGG No data
1073327145_1073327149 11 Left 1073327145 10:102649664-102649686 CCCTCTCTGGGGTCTGCCGGGCT 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1073327149 10:102649698-102649720 TGCTGCCTCTCTCCTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073327145 Original CRISPR AGCCCGGCAGACCCCAGAGA GGG (reversed) Intronic
900403338 1:2481835-2481857 GGCCCTGCAGAGCCGAGAGAAGG + Intronic
900500761 1:3003437-3003459 AGCCGTGCAGACCCCGGAGCTGG - Intergenic
900619504 1:3580402-3580424 GGCCAGTCAGACCCCAGGGAGGG + Intronic
900830916 1:4964825-4964847 AGCCCTGCAGGTCCCAGAGCTGG + Intergenic
901492512 1:9603633-9603655 ATCCCGGCAGACCCAGGTGACGG - Intronic
901624219 1:10614541-10614563 AGCCCAGAGGGCCCCAGAGAAGG + Intronic
901772498 1:11537380-11537402 AGCCCCAGAGCCCCCAGAGAGGG - Exonic
902554836 1:17240782-17240804 AGCCCCGCAGACCCCCCAGCAGG - Intronic
902781718 1:18709222-18709244 AGCCCTCCAGACCCCAGCCAAGG - Intronic
903230835 1:21921513-21921535 TGCCCCGCATACCCCAGAGCAGG + Intronic
904825233 1:33269926-33269948 AGCCCAGCAAGCTCCAGAGAGGG - Intronic
907332022 1:53677731-53677753 GGCACGGCAGATCCCAGAGATGG - Intronic
907592174 1:55685732-55685754 AGGCAGACACACCCCAGAGATGG - Intergenic
910473511 1:87580566-87580588 AGCCAGGCAGACTCCTGAAATGG + Intergenic
912593223 1:110848664-110848686 AGCCCAGCAGAACACAGACAAGG - Intergenic
914350162 1:146833514-146833536 AGCCTGGCAGCCCCCTGAGATGG - Intergenic
915011100 1:152686992-152687014 ACCACAGCAGCCCCCAGAGATGG - Exonic
915513620 1:156400571-156400593 AGCCTGGCCAACCTCAGAGAGGG - Intergenic
916062089 1:161106400-161106422 TACCTGGCAGACCCCAGAAATGG - Intronic
919724133 1:200871198-200871220 AGCCAGGGAGACCCCATAGTAGG - Intergenic
919918893 1:202156625-202156647 AGCCCTGCAGCCACCAGAAAAGG - Intronic
920698887 1:208202994-208203016 TCCCCAGCAGACCCCAGGGAAGG - Intronic
920966390 1:210704949-210704971 AACCCCACAAACCCCAGAGAAGG - Intronic
922051449 1:221994386-221994408 AGCACAGCAGACCTCAGGGAAGG + Intergenic
922747239 1:228051182-228051204 GCCCCGGCAGAGCCCAGGGAGGG + Intronic
1062962381 10:1582340-1582362 TGCTGGGCAGACCCCAGTGAGGG - Intronic
1067044470 10:42976477-42976499 AGCCAGGCTGCCCCCAGGGAAGG + Intergenic
1067456804 10:46425002-46425024 AGCCCTGCAGAGGCCAGAGACGG - Intergenic
1067630397 10:47959637-47959659 AGCCCTGCAGAGGCCAGAGACGG + Intergenic
1068991278 10:63153609-63153631 AGCCCAGCAGAACACAGACAAGG + Exonic
1070793483 10:79203450-79203472 AGCCCTGCAGAACCCTGAGTGGG - Intronic
1070809123 10:79288742-79288764 AGGCCAGCAGATCCCAGCGAAGG - Intronic
1073327145 10:102649664-102649686 AGCCCGGCAGACCCCAGAGAGGG - Intronic
1074451367 10:113562400-113562422 GGCCTGGCAGGCCACAGAGAGGG - Intronic
1075778486 10:125002737-125002759 AGCCCCGCAGACCCCACACAAGG + Intronic
1076170136 10:128312314-128312336 AGCCTGACAGATCCCATAGATGG + Intergenic
1076420817 10:130330486-130330508 CGCCCTGCAGACCCAAGTGATGG + Intergenic
1076809705 10:132880146-132880168 AGGCCGGCAGAGCCCAGCTAGGG - Intronic
1077318154 11:1928377-1928399 GGCCAGGCAGACCCCAGAGGTGG + Intronic
1079161150 11:17995336-17995358 AGGCAGGCACACCCCAAAGAGGG - Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1083730142 11:64648431-64648453 AGCCAGGCAGAGCTCAGAGTAGG - Intronic
1084761374 11:71273596-71273618 AGCAGAACAGACCCCAGAGATGG + Intergenic
1086970275 11:93073877-93073899 AGCCCAGCAGGCCCCTAAGAGGG - Intergenic
1088771029 11:113036375-113036397 AGCCAGGCAGGCCAGAGAGAAGG - Intronic
1089518320 11:119047793-119047815 GGCCCGGCTCATCCCAGAGATGG - Exonic
1090411187 11:126511109-126511131 ATCCCTGCAGACTCTAGAGATGG - Intronic
1091173867 11:133542600-133542622 AGCCCTGCAGAAGGCAGAGATGG + Intergenic
1091222366 11:133936877-133936899 AGCCCCAGAGTCCCCAGAGAGGG - Intronic
1091286613 11:134411913-134411935 AGCCCGACAGTCCCCGGGGAGGG - Intronic
1095946763 12:47758238-47758260 AGACCGGCAGGCCCCAGTGAAGG - Intronic
1096596367 12:52698391-52698413 ATCCCGGCAGACAGCAGAGGTGG - Intronic
1096771439 12:53938496-53938518 CCCCCGGCAGGCCCCAGGGAGGG - Intergenic
1100464014 12:94829180-94829202 ACCCCCTCATACCCCAGAGATGG + Intergenic
1100796973 12:98192539-98192561 AGTCAGGCAGACCCCTGGGAAGG + Intergenic
1101873448 12:108583306-108583328 AGACCTGCAAACCCCAGGGAGGG - Intergenic
1102189983 12:110980404-110980426 AGCTGGGCAGACCCCTGACAAGG + Intergenic
1103917952 12:124385575-124385597 AGCCCGGGAGTACCCCGAGATGG - Intronic
1103927629 12:124432686-124432708 ACCCCAGCAGCTCCCAGAGAGGG + Intronic
1106656874 13:31755972-31755994 CACCCGGCTGACCCCAGAGAGGG + Intronic
1107014114 13:35695248-35695270 AGCCCGGGAGGGGCCAGAGAGGG - Intergenic
1107212107 13:37869956-37869978 AGCCCGGCAGCCACCAGGGACGG - Exonic
1108162654 13:47658129-47658151 AGACAGGAAGGCCCCAGAGAAGG - Intergenic
1112350250 13:98627219-98627241 ACCCCTGCAGACACCAGGGATGG + Intergenic
1117467153 14:56005084-56005106 AGTCCGGCAGACCTGGGAGACGG - Intergenic
1119515697 14:75246570-75246592 AGTCCTGATGACCCCAGAGATGG - Intronic
1119650965 14:76382438-76382460 GGTGGGGCAGACCCCAGAGAGGG + Intronic
1120824762 14:88945210-88945232 AGCCAGACAGACCCCACAAATGG + Intergenic
1120866487 14:89299662-89299684 GGCCGTGCTGACCCCAGAGAGGG + Intronic
1121015492 14:90546436-90546458 AGCCTGGCTGAACCCAGGGAAGG - Intronic
1121430478 14:93882879-93882901 AGCACGGCAGACTCAAGAGATGG + Intergenic
1122243126 14:100382298-100382320 AGCCCGGCAGGGCTCAGTGAAGG + Intronic
1122540899 14:102497167-102497189 CGCCCAGCAGCCCCCAGTGATGG - Intronic
1122613819 14:103003167-103003189 ACGCGGGCAGACCTCAGAGAAGG - Intronic
1122857693 14:104567778-104567800 ATCCCGGCAGGGTCCAGAGAGGG - Intronic
1123063903 14:105606630-105606652 AGGCTGGCAGAGGCCAGAGATGG - Intergenic
1123069067 14:105632316-105632338 AGGCTGGCAGAGGCCAGAGATGG - Intergenic
1123073218 14:105652273-105652295 AGGCTGGCAGAGGCCAGAGATGG - Intergenic
1123093144 14:105751044-105751066 AGGCTGGCAGAGGCCAGAGATGG - Intergenic
1123888682 15:24752584-24752606 GCCCCTGCAGACCCCACAGAAGG - Intergenic
1124671900 15:31648166-31648188 TGCCCGGCAGGCCCCTAAGAGGG - Intronic
1124948823 15:34296746-34296768 AGCATGGCAGAACACAGAGAAGG + Intronic
1126055966 15:44729595-44729617 AAACGGGCGGACCCCAGAGAAGG - Intronic
1126848509 15:52784115-52784137 AGCCCGGCTACCCCCAGAAAGGG + Intronic
1127558776 15:60114966-60114988 TGCCCGGCAGAACACAGGGATGG + Intergenic
1128894279 15:71358131-71358153 AGCCCTTCAAAGCCCAGAGAAGG - Intronic
1129742991 15:77999132-77999154 GGCCTGGCAGAATCCAGAGAGGG - Intronic
1129842487 15:78752307-78752329 GGCCTGGCAGAATCCAGAGAGGG + Intergenic
1130181510 15:81634021-81634043 AGCCAGGCAGCCACCAGAGCTGG + Intergenic
1131097330 15:89664653-89664675 AGCCCTGCATACACAAGAGATGG + Exonic
1132038517 15:98505671-98505693 CCCCCGGCACAGCCCAGAGAGGG + Intronic
1132144173 15:99417072-99417094 ATCCAGGCCCACCCCAGAGATGG - Intergenic
1132339386 15:101068521-101068543 ATCTCAGCACACCCCAGAGAGGG + Intronic
1132693199 16:1190804-1190826 GGCCCTGCAGACCCAAGAGCTGG + Intronic
1134007476 16:10827913-10827935 ATCCCGGCTGGCCGCAGAGAAGG - Intergenic
1137484765 16:48881950-48881972 AGCAGGGGAGACCCCAGGGAGGG + Intergenic
1138121126 16:54401825-54401847 AGCCAGGAAGATCCCAGGGAGGG - Intergenic
1139983877 16:70882017-70882039 AGCCTGGCAGCCCCCTGAGATGG + Intronic
1140450309 16:75065274-75065296 AGCCCTGCAAACCCCAGTGCAGG - Intronic
1142289199 16:89185045-89185067 AGCACGGCTGACCCCAGATGGGG - Intronic
1143904553 17:10198510-10198532 ACCCCCGCGCACCCCAGAGACGG - Exonic
1144668535 17:17118354-17118376 AACCTGGCAGACCCCAGAGAGGG - Intronic
1145257872 17:21337483-21337505 GGCCCAGGAGACCCCAGAGAGGG - Intergenic
1145780921 17:27562552-27562574 AGCCAGGTAGTCCCCAGAGGGGG - Intronic
1145794136 17:27645728-27645750 GGCCCCACAGACCCCACAGAGGG - Intronic
1145808938 17:27753269-27753291 GGCCCCACAGACCCCACAGAGGG - Intergenic
1148063278 17:44851063-44851085 AGCCCGGCAGAGGCCACAGAAGG + Exonic
1148129635 17:45255080-45255102 AGCCCCGCAGCTCCCATAGAGGG - Intronic
1148367718 17:47069163-47069185 ACCCCGGCTGACCCAAGAGTTGG - Intergenic
1148878776 17:50708869-50708891 ATCCCAGCAGCCCCAAGAGACGG - Intergenic
1149850593 17:60031473-60031495 AGCCCTGCCTTCCCCAGAGAAGG - Intergenic
1149851430 17:60037852-60037874 AGGCCAGGAGACCCCAGAGGGGG + Intergenic
1149859573 17:60115051-60115073 AGCCCTGCCTTCCCCAGAGAAGG + Intergenic
1150148091 17:62787622-62787644 AGGCAGTCTGACCCCAGAGAAGG - Intronic
1151283915 17:73096240-73096262 AGCCCAGCTGACTCCTGAGATGG + Intergenic
1151472144 17:74325279-74325301 AGCCCGGCAGCCCCAAGACTGGG - Intergenic
1151628728 17:75295240-75295262 AGCCCGGAAGACCACAGTGAGGG - Intergenic
1151850113 17:76685036-76685058 AGCCCGCCAGGCGCCAGCGAAGG + Intronic
1152037145 17:77880470-77880492 AGCCAGTCAGATCCCAGCGAAGG + Intergenic
1152122105 17:78425168-78425190 AGCCACGCTGACCCTAGAGAGGG - Intronic
1152291334 17:79441751-79441773 GCCCCGGCAGACCCCAGGGTGGG + Intronic
1156948137 18:42860231-42860253 AGCCTAGCAGCCACCAGAGAGGG - Intronic
1157709904 18:49843062-49843084 TGCCTGGCAGTTCCCAGAGAAGG - Intronic
1158564992 18:58547342-58547364 AGCCAGTGGGACCCCAGAGAGGG + Intronic
1158954483 18:62524820-62524842 GGCCCGGCAGAGCCCGGAGACGG - Intronic
1159953942 18:74506535-74506557 AGCCTGGCAGACGCCAGCCACGG - Intronic
1160376287 18:78415050-78415072 AGTCCTGCAGACCCCACAGCGGG + Intergenic
1160796473 19:947995-948017 GGCCAGGCAGAGCCCAGAGAGGG + Intronic
1160869974 19:1273279-1273301 AGCTCTGCAGGCCCCAGGGAAGG - Intronic
1161101671 19:2424707-2424729 AGCCCTGCAGAGCCCAGAGCTGG - Intronic
1162550950 19:11357825-11357847 AGCAAGGGAGATCCCAGAGATGG - Intronic
1162936471 19:13983999-13984021 AGCCAGGGTCACCCCAGAGAAGG - Intronic
1163934046 19:20425142-20425164 AGCCAGGCTCACCCCAGAGAAGG + Intergenic
1164807449 19:31127880-31127902 AGCCCTTCAGTCACCAGAGATGG - Intergenic
1165182536 19:33985013-33985035 ATCCCCACAGACCCCAGAGTGGG - Intergenic
1166341986 19:42143573-42143595 AGCCTGGGAGGCCACAGAGAAGG + Intronic
1167104082 19:47420165-47420187 AGGCCGGCGCACCCCAGATAGGG + Intergenic
1167613079 19:50516742-50516764 CACCCTGGAGACCCCAGAGAAGG - Intergenic
1168105660 19:54164458-54164480 AGCCCAGTAGACGCCATAGAAGG + Exonic
1168471333 19:56643174-56643196 AGCTCTGCAGAGCCCAGACAGGG + Exonic
1168686464 19:58352247-58352269 CCCCCAGCAGCCCCCAGAGATGG + Intronic
1168724045 19:58570994-58571016 AGCCGGGCGGACCCCGGAGATGG - Exonic
925157427 2:1658493-1658515 AGCCCCGCAGACCCCAGCTGTGG + Intronic
927973033 2:27317583-27317605 AGCCCAGGAGACTGCAGAGAAGG - Intronic
929949241 2:46393690-46393712 AGCCCAGCAGAGCTCAGAGTTGG - Intergenic
935216801 2:100981371-100981393 AGCCCCGAAGAGCCCAGAGCAGG + Intronic
935529743 2:104217964-104217986 AGCCCAGCAGACACGTGAGAAGG + Intergenic
935601378 2:104925569-104925591 AGCCATGCAGAACCTAGAGAAGG + Intergenic
935677883 2:105611312-105611334 AGCCCGGCAGTGACCACAGAAGG - Intergenic
935809131 2:106779613-106779635 AGCCCAGTAAACCCCAGGGAAGG - Intergenic
936165554 2:110116516-110116538 ACACCGGCAGGCACCAGAGAAGG + Exonic
936531060 2:113277525-113277547 AGCCCGGCCGGCCGCAGAGAAGG - Intronic
937358521 2:121213149-121213171 AGCTCGGCAGGCCCCAGCGCAGG - Intergenic
937363511 2:121244898-121244920 GGACCGGCAGATCCCAGAGCAGG + Intronic
944542980 2:200771313-200771335 AGGCAGGCAGACCCCAGCCAAGG + Intergenic
946490631 2:220145938-220145960 AGCCTGGCAGTCCCTAGGGAAGG - Intergenic
948892388 2:240913849-240913871 AGCCCGGCCCGCCGCAGAGAGGG - Intergenic
1169193809 20:3672992-3673014 AGACGCGCAGAGCCCAGAGAGGG + Intronic
1169242405 20:3995195-3995217 TGCCAGGCACACCCCAGAGGTGG - Intronic
1174267996 20:49345793-49345815 AGGCCGCCACACCCCGGAGAAGG - Intergenic
1174579038 20:51557965-51557987 AGGCCAGCAGAGCCCAGAGGAGG + Intronic
1176051055 20:63119981-63120003 AGCCCGGTACACACCAGTGAGGG + Intergenic
1176259199 20:64170361-64170383 GGCCCAGCAGCCCCCAGAGCTGG - Intronic
1176665670 21:9685331-9685353 AACAGGGCAGACCCCACAGAGGG + Intergenic
1177372101 21:20217940-20217962 AGCCTGGCAGGTCCCAGACAAGG - Intergenic
1178327031 21:31654468-31654490 AGCACAGCAGCCCACAGAGAGGG - Intergenic
1179937403 21:44614080-44614102 ACCCCGACAGACACCAGAGCAGG - Intronic
1180138821 21:45878404-45878426 AGCCCTGGAGATCACAGAGAGGG + Intronic
1183985437 22:41567553-41567575 AGCCCGAGAGACCAGAGAGAAGG - Intronic
1184664681 22:45982042-45982064 AGCCCCACAGTTCCCAGAGAAGG + Intergenic
1184889214 22:47369242-47369264 AGCCCTGCAGACCCCAGCAGGGG - Intergenic
1185048007 22:48538594-48538616 AGCACGGCAGACCCATGAGCAGG - Intronic
949908933 3:8884107-8884129 AGGCTGACAGTCCCCAGAGAAGG - Intronic
950031834 3:9858848-9858870 AGGCAGGCAGAGCCCAGACACGG - Intergenic
950319387 3:12036119-12036141 GGCCCAGCAGACCCCTAAGAGGG + Intronic
950331273 3:12158156-12158178 AGCCCGGGAGCCTGCAGAGAAGG + Intronic
953407062 3:42664764-42664786 AGGCTGGCAGGCCCCAGAGCTGG + Exonic
953438075 3:42895705-42895727 AGCCTGGCAGCCACCAGAGGGGG - Intronic
959567698 3:107849386-107849408 GGACAGGAAGACCCCAGAGAGGG + Intergenic
960442579 3:117707198-117707220 ACCCCTGCAGACCTCATAGAGGG + Intergenic
961516756 3:127442791-127442813 AGCCAGGAAGCCCCCAGGGAGGG - Intergenic
961810772 3:129520297-129520319 AGCCCAGCAGACCCCAAGGCGGG - Exonic
961814138 3:129539788-129539810 GGCCTGGCAGAGCCCAGAGGAGG + Intergenic
962198187 3:133380754-133380776 AGCCGTGAAGACCCCAGAGCTGG - Exonic
962977873 3:140461755-140461777 ATCCCAGCAGTCCCCTGAGAAGG + Intronic
964183373 3:153913784-153913806 AGCCAGCTAGACCACAGAGATGG - Intergenic
965843831 3:172938576-172938598 AGGCCCGCAGACTCCAAAGAGGG - Intronic
966881026 3:184351369-184351391 GGCGAGGCAGACCCCAGAGGAGG - Intronic
967986167 3:195097024-195097046 CGCCCAGCAGACCCCTCAGACGG + Intronic
968961190 4:3744512-3744534 ACGCAGGCAGACCCCAGAGGAGG + Intergenic
969700386 4:8764659-8764681 AGCCACGCAGACCCCAAGGAAGG + Intergenic
970805426 4:20024959-20024981 ATCCCCAGAGACCCCAGAGATGG + Intergenic
971713730 4:30149730-30149752 AGCCAGGAAGAGCCAAGAGAAGG - Intergenic
971956819 4:33430987-33431009 AGGCCTGCAGACCTCAGGGAAGG - Intergenic
972380444 4:38514513-38514535 AGCCCAGAAAACCCCTGAGATGG + Intergenic
973757222 4:54087199-54087221 AGCACCTCAGACCCCAGGGAAGG + Intronic
976618249 4:87100223-87100245 AGCCCAGCATCCCACAGAGAGGG - Intronic
978062460 4:104354521-104354543 AGCCTGCCACACCCCACAGATGG + Intergenic
985120725 4:186638914-186638936 AGACAGGCAGACCGCAGAGAGGG - Intronic
985411393 4:189689595-189689617 AACAGGGCAGACCCCACAGAGGG + Intergenic
985556385 5:560402-560424 TGCCGGGCAGACCCCAGCGTGGG - Intergenic
985679599 5:1249042-1249064 AGGCCAGCCGGCCCCAGAGATGG + Intergenic
985895462 5:2748259-2748281 CGCCCGGGAGACCCGAGGGAGGG - Intronic
986318415 5:6607320-6607342 AGCCCTGCAGATCTCACAGAAGG - Exonic
986379433 5:7168514-7168536 AGCCAGGAAGAAACCAGAGAAGG - Intergenic
989971949 5:50535614-50535636 AGCCCAGCTGACACCTGAGAGGG - Intergenic
990561165 5:56984641-56984663 TGCCCTGCAGACCTCAGACATGG + Intergenic
990665724 5:58069388-58069410 AGCCCGGCTGCCCCCAGTGCGGG + Intergenic
991587349 5:68215070-68215092 AGCCAGGCGGACCCGCGAGAAGG - Intergenic
995476380 5:112552525-112552547 AGCCCAGCACACCCCAACGAAGG + Intergenic
999653448 5:153790104-153790126 AGCAAGGCTAACCCCAGAGATGG + Intronic
999721165 5:154400269-154400291 AGCAGGGCAGTCCCAAGAGAGGG - Intronic
1000060472 5:157651450-157651472 AGCCCGGCAGCCATCCGAGAAGG - Exonic
1001407027 5:171483665-171483687 ATCCCCGCAGACCCATGAGAGGG - Intergenic
1002425313 5:179171513-179171535 AGCCCAGAACCCCCCAGAGAAGG + Intronic
1004354635 6:14920423-14920445 AGCACAGCAGACACCAGAGCTGG + Intergenic
1006299615 6:33186580-33186602 AGTGCAGCACACCCCAGAGAGGG - Intronic
1006473697 6:34242180-34242202 ATCCAGGCTGCCCCCAGAGAAGG - Intronic
1007397439 6:41585785-41585807 GGCCCGGCAGACACCACACACGG - Intronic
1007925489 6:45646541-45646563 AGACCGGAAGAACCCAGTGAGGG - Intronic
1011185191 6:84667346-84667368 AGCCCGGTAGCCCCAAAAGATGG + Intergenic
1013429227 6:110040995-110041017 AGCCCAGCAGGCCCCTAAGATGG - Intergenic
1013515107 6:110877473-110877495 AGCCCCAGAGACCCCAGGGAAGG + Intronic
1014535782 6:122611125-122611147 ACCCCGGCAGGCCGCAGGGAGGG + Intronic
1017873779 6:158506818-158506840 AGCCCGGCAGGCCCAGGAGAGGG + Exonic
1019119124 6:169789502-169789524 AGGCAGGCAAACCCCAGAGAAGG + Intergenic
1019348380 7:541505-541527 TGCCCTGCAGACCTCAGACAGGG - Intergenic
1019618674 7:1978916-1978938 ACTCCGGCAGATCCCAGAGAGGG + Intronic
1021452040 7:20791526-20791548 AGTCGGCCAGAGCCCAGAGAGGG + Intergenic
1024331309 7:48158381-48158403 AGCCCCGCACAGACCAGAGAGGG - Intergenic
1024338923 7:48237612-48237634 AGTCAGACAGACCCCAGGGAGGG - Intronic
1025256062 7:57384578-57384600 GGCCCTGCAGACAGCAGAGACGG - Intergenic
1026871536 7:73855784-73855806 AGGCTGGCAGACCTCAGAGGTGG + Intergenic
1029595711 7:101536559-101536581 AGGCAGGCAGATCCCAGACAGGG + Intronic
1032276354 7:130459546-130459568 AGCCCGGCAGCCACCAGAGAGGG - Intergenic
1034676664 7:152897070-152897092 AGCCCTGCAGTCCCAAGAGGTGG - Intergenic
1034715397 7:153236918-153236940 ATCCCAGCAGAGCCCAAAGAGGG + Intergenic
1036790062 8:11711276-11711298 ATCCGGGAAGAGCCCAGAGAAGG - Intronic
1037776512 8:21839081-21839103 AGCCAGGCACACAGCAGAGATGG + Intergenic
1038775523 8:30527341-30527363 AGGCTGGGAGACCCCAGAAAAGG - Intronic
1039373688 8:37012509-37012531 AGGCAGGCAGACTCCAAAGAAGG + Intergenic
1039895856 8:41715922-41715944 AGCAAGGCAGGGCCCAGAGAGGG + Intronic
1045769670 8:105721156-105721178 AGCCCTGCAGATCCCACAGATGG + Intronic
1045962407 8:107983370-107983392 AGCCCAGCAGAACACAGACAAGG + Intronic
1046776444 8:118168632-118168654 TGCCAGGCACACCCCAGATAGGG + Intergenic
1048025656 8:130584321-130584343 AGACAGGCAGATCCCAGAGGTGG + Intergenic
1048314834 8:133354152-133354174 AGGCCTGCATATCCCAGAGAGGG + Intergenic
1048573457 8:135673107-135673129 CGCCCTGCAGACCCCAGAAGGGG + Intergenic
1049312294 8:141939524-141939546 AGCCCCACACACCCCACAGAAGG + Intergenic
1049365550 8:142235195-142235217 ATACCCGCAGGCCCCAGAGAAGG + Intronic
1049365560 8:142235234-142235256 ATACCCGCAGGCCCCAGAGAAGG + Intronic
1049495052 8:142926126-142926148 GGCCTGGCACACCCCACAGAGGG + Intergenic
1053519315 9:38762275-38762297 TGCCCGGCTGTCTCCAGAGAGGG + Intergenic
1054807794 9:69410126-69410148 AGCCAGGATGAGCCCAGAGAAGG + Intergenic
1057607844 9:96513759-96513781 GGCCCTGCAGCCTCCAGAGAAGG + Intronic
1060408041 9:123382331-123382353 AGGCAGGAAGACCCCAGAGCTGG - Exonic
1060778977 9:126397965-126397987 AGCCCTGCAGGCCCCACTGAGGG - Intronic
1061241906 9:129379262-129379284 ATTCCGGCAGCCCCCACAGATGG + Intergenic
1061970249 9:134041076-134041098 GGCCCTGCAGTCCCCAGAGTTGG - Intronic
1203660433 Un_KI270753v1:36430-36452 AACAGGGCAGACCCCACAGAGGG - Intergenic
1203671203 Un_KI270755v1:13387-13409 AACAGGGCAGACCCCACAGAGGG - Intergenic
1185432927 X:19837-19859 AGCCCGGCCGAGCCCCGAGTGGG + Intergenic
1185442279 X:232659-232681 AGCCCGGCCGAGCCCCGAGTGGG + Intergenic
1199992895 X:152999038-152999060 GGGCCTGCAGACCCCTGAGACGG - Intergenic
1200299766 X:154961697-154961719 GGCCAAGGAGACCCCAGAGATGG + Intronic
1201355957 Y:13097301-13097323 AGCCAGGATGAGCCCAGAGAAGG - Intergenic
1201586831 Y:15570257-15570279 AGCCCAGAAGACCCCTAAGAGGG + Intergenic