ID: 1073336514

View in Genome Browser
Species Human (GRCh38)
Location 10:102714289-102714311
Sequence CAGGAGGAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13586
Summary {0: 7, 1: 321, 2: 1261, 3: 3333, 4: 8664}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073336514_1073336530 11 Left 1073336514 10:102714289-102714311 CCCTCCTCCTCCTCCTCCTCCTG 0: 7
1: 321
2: 1261
3: 3333
4: 8664
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336514_1073336523 -2 Left 1073336514 10:102714289-102714311 CCCTCCTCCTCCTCCTCCTCCTG 0: 7
1: 321
2: 1261
3: 3333
4: 8664
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336514_1073336522 -3 Left 1073336514 10:102714289-102714311 CCCTCCTCCTCCTCCTCCTCCTG 0: 7
1: 321
2: 1261
3: 3333
4: 8664
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336514_1073336524 -1 Left 1073336514 10:102714289-102714311 CCCTCCTCCTCCTCCTCCTCCTG 0: 7
1: 321
2: 1261
3: 3333
4: 8664
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073336514 Original CRISPR CAGGAGGAGGAGGAGGAGGA GGG (reversed) Exonic
Too many off-targets to display for this crispr