ID: 1073336522

View in Genome Browser
Species Human (GRCh38)
Location 10:102714309-102714331
Sequence CTGCTGCCTCCCCCGTTACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 164}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073336510_1073336522 10 Left 1073336510 10:102714276-102714298 CCTCCCGCCGAGTCCCTCCTCCT 0: 1
1: 1
2: 3
3: 65
4: 736
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336515_1073336522 -4 Left 1073336515 10:102714290-102714312 CCTCCTCCTCCTCCTCCTCCTGC 0: 37
1: 2424
2: 6754
3: 13394
4: 22576
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336506_1073336522 25 Left 1073336506 10:102714261-102714283 CCCCACACTCACCATCCTCCCGC 0: 1
1: 1
2: 1
3: 50
4: 543
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336516_1073336522 -7 Left 1073336516 10:102714293-102714315 CCTCCTCCTCCTCCTCCTGCTGC 0: 9
1: 108
2: 3211
3: 8811
4: 17727
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336517_1073336522 -10 Left 1073336517 10:102714296-102714318 CCTCCTCCTCCTCCTGCTGCCTC 0: 1
1: 4
2: 229
3: 2512
4: 10356
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336514_1073336522 -3 Left 1073336514 10:102714289-102714311 CCCTCCTCCTCCTCCTCCTCCTG 0: 7
1: 321
2: 1261
3: 3333
4: 8664
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336507_1073336522 24 Left 1073336507 10:102714262-102714284 CCCACACTCACCATCCTCCCGCC 0: 1
1: 0
2: 0
3: 44
4: 478
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336511_1073336522 7 Left 1073336511 10:102714279-102714301 CCCGCCGAGTCCCTCCTCCTCCT 0: 1
1: 0
2: 3
3: 86
4: 636
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336513_1073336522 3 Left 1073336513 10:102714283-102714305 CCGAGTCCCTCCTCCTCCTCCTC 0: 1
1: 7
2: 138
3: 860
4: 4094
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336512_1073336522 6 Left 1073336512 10:102714280-102714302 CCGCCGAGTCCCTCCTCCTCCTC 0: 1
1: 0
2: 16
3: 207
4: 1408
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336505_1073336522 26 Left 1073336505 10:102714260-102714282 CCCCCACACTCACCATCCTCCCG 0: 1
1: 0
2: 4
3: 80
4: 484
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336509_1073336522 14 Left 1073336509 10:102714272-102714294 CCATCCTCCCGCCGAGTCCCTCC 0: 1
1: 0
2: 4
3: 35
4: 489
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1073336508_1073336522 23 Left 1073336508 10:102714263-102714285 CCACACTCACCATCCTCCCGCCG 0: 1
1: 0
2: 0
3: 30
4: 270
Right 1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG 0: 1
1: 0
2: 1
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073336522 Original CRISPR CTGCTGCCTCCCCCGTTACC AGG Exonic
900388168 1:2420017-2420039 GTGCTGCCTCCCCAGTAGCCTGG + Intergenic
901647281 1:10723504-10723526 CTGCTGCCTCACCCCTGCCCCGG + Intronic
905422731 1:37859541-37859563 CTGCTGCTGCCGCCGTTGCCGGG - Exonic
905583285 1:39098415-39098437 CCACTGCCTCCCCCATTACAAGG + Intronic
906952948 1:50349339-50349361 CTGCTCCTTCCCCTGTTGCCTGG + Intergenic
917476652 1:175374711-175374733 CTGCTGCCTCTCCCTGCACCAGG - Intronic
920216137 1:204362619-204362641 CTGCAGCCTCCACCTCTACCTGG + Intronic
920306237 1:205019961-205019983 CAGCTGCCTCCCACCTTGCCTGG + Exonic
921556138 1:216601072-216601094 CTGCTGCCGCCCGCGCTGCCGGG - Intronic
923273839 1:232379976-232379998 GTGCTGGCTCCCCTGTTCCCTGG + Intergenic
1064234549 10:13562202-13562224 CAGCTGCCTCCCCGGCCACCAGG + Intergenic
1064641642 10:17421168-17421190 CTGATGCCTAGCCCCTTACCTGG + Intronic
1070338046 10:75472286-75472308 CTTCTGCCTCCTTCATTACCTGG - Intronic
1072656466 10:97333917-97333939 CTGCGGCCTCCCCCGGGCCCAGG + Exonic
1073336522 10:102714309-102714331 CTGCTGCCTCCCCCGTTACCAGG + Exonic
1075580297 10:123612388-123612410 CTGCTGCTTCCCCCCTTCCATGG + Intergenic
1076595456 10:131622348-131622370 CGGCTTCCTCCCCTGTGACCTGG - Intergenic
1076695080 10:132243422-132243444 CCCCTGCCTGCCCCCTTACCCGG - Intronic
1077061545 11:619881-619903 CTGCTGCCTCCCCCGCCTCCAGG - Exonic
1077192819 11:1262557-1262579 CAGCTGCCTCCCCGCTGACCGGG - Intergenic
1078641595 11:13101831-13101853 TTGCTGCCTCCCTCCTCACCAGG - Intergenic
1078725743 11:13929472-13929494 CTGCTGCCACCCCCATCCCCTGG - Intergenic
1079415334 11:20229755-20229777 CTGCTGCCTCCCCAGTTCTGTGG - Intergenic
1080386692 11:31814716-31814738 CTGGTGCCTCCCCCACTTCCAGG + Intronic
1081731904 11:45377561-45377583 CTGCTGGCTCCCCAGTGACTGGG + Intergenic
1083429120 11:62604874-62604896 CTGCTGCCTCCTCCACTCCCAGG + Intronic
1083475124 11:62910388-62910410 CTGCTGCCACCCCCTTTGCCTGG + Exonic
1083941121 11:65896513-65896535 CTCCTGCCACCCCCGCTACCTGG + Intronic
1084495935 11:69503394-69503416 CAGCTGCCTCACCCTTTACTAGG - Intergenic
1085120592 11:73965087-73965109 CAGCTGCCTCCTCCCTTACCTGG + Intronic
1090207396 11:124893411-124893433 CTGCTGCCTCACCCGCTAGGTGG - Intronic
1090828317 11:130403470-130403492 CTGCTGCCTGCATCATTACCAGG - Intergenic
1097940022 12:65293961-65293983 CTGCTTCCTTCCCCTCTACCTGG - Intronic
1102229892 12:111255405-111255427 CTGCTGGGGCCCCCGTTCCCTGG - Intronic
1102819339 12:115894684-115894706 CTGCTGCCTCCCCCTTGCTCTGG - Intergenic
1103363506 12:120367758-120367780 CGGCTGCCTCTCCCCTCACCAGG + Intronic
1104651631 12:130538894-130538916 CTGCTTCCTCCCACCTTGCCTGG - Intronic
1104846842 12:131851215-131851237 CTGCTGCCGCCACTGTCACCAGG + Exonic
1107450787 13:40507199-40507221 TTGCTTCCCCTCCCGTTACCTGG - Intergenic
1108704464 13:52972751-52972773 CTGCTGGCTCCCCTGTTTTCTGG + Intergenic
1110998345 13:82142484-82142506 CTTCAGCCTCCCCAGTTAGCTGG - Intergenic
1111799444 13:92964048-92964070 CTGATGCCTACCAGGTTACCTGG - Intergenic
1115486056 14:33912226-33912248 CTGCTGCCTCCACAGCTGCCTGG - Intergenic
1117980975 14:61341551-61341573 CTGCTGCCTCCCTCACTACAGGG - Intronic
1118743341 14:68756925-68756947 CTGCGGCCTTCCCCTTTACCTGG + Intergenic
1122626767 14:103089056-103089078 CTGCTGCCTCTCCTGTTCCTTGG - Intergenic
1122901483 14:104784022-104784044 CTGCTGCTTCCCCCTTGCCCAGG - Intronic
1126137632 15:45407270-45407292 CTGCTACCTCTCCCTGTACCAGG + Intronic
1128385195 15:67142681-67142703 CAGCAGCCTCTGCCGTTACCAGG - Intronic
1128498920 15:68213876-68213898 CTGCTGCCTCTCCTGCCACCTGG + Intronic
1130350265 15:83085176-83085198 CTGCTGCCTCCCCACTTCCCAGG - Intergenic
1131059147 15:89393746-89393768 CTTCAGCCTCCCCAGTTACTGGG - Intergenic
1132524451 16:407395-407417 CTGCTGTCTGCCTCTTTACCTGG + Intronic
1132667877 16:1090256-1090278 CTGCTGCCTCCCAAGTCGCCCGG - Exonic
1137766734 16:50983366-50983388 CTCCTGACTCCCCTGTTGCCAGG + Intergenic
1138476191 16:57271906-57271928 CTGCTTCCTCCCTCCTTCCCAGG + Intronic
1140826646 16:78713194-78713216 CTGCAGCCTCCACCTCTACCAGG - Intronic
1141343787 16:83227320-83227342 CTGCTGCCTCCTCCCTTATCAGG - Intronic
1141761644 16:86032698-86032720 CTTCTGCCTCCACCCTGACCTGG + Intergenic
1141889748 16:86918712-86918734 CTGATGCCACCCTCGTTCCCAGG - Intergenic
1142001551 16:87667144-87667166 CTGCTGTCTCCCTCGTCACGTGG + Intronic
1142011202 16:87715137-87715159 CTGGTGCCACACCCATTACCTGG + Intronic
1142352443 16:89586409-89586431 CTGCTTCCTCCCCCGTCCCTGGG + Intronic
1142595479 17:1027689-1027711 GTGCTGCCTCCCCCGAGAGCTGG - Intronic
1146692753 17:34888023-34888045 CTGCTGCCTCCCTCAGCACCAGG + Intergenic
1147061360 17:37881386-37881408 CTTCTGCCTCCCCCGTTCAAAGG - Intergenic
1147263975 17:39224315-39224337 CTCCTCCCTCCCCCTTCACCCGG - Intronic
1147650590 17:42059536-42059558 CTGCGGACTCCCCCTCTACCTGG - Intronic
1148533740 17:48420570-48420592 CTTCTGCCACCCCAGTTATCAGG - Intronic
1148680907 17:49473007-49473029 CTCCTGCCTTCCCCCTTTCCTGG + Intronic
1150435012 17:65146991-65147013 CTGTTGCCTCCTCAGTTCCCTGG + Intronic
1151990295 17:77570292-77570314 CTGCTACCTGCTCCGTTCCCCGG + Intergenic
1152080517 17:78184545-78184567 TGGCTGGCTCCCCCGTCACCTGG - Intronic
1152459055 17:80431828-80431850 CTGCTGCCTCTCCCTTTCCAAGG - Intronic
1152476778 17:80523479-80523501 CTGTTGCCTCTGCCGTCACCAGG - Intergenic
1152646828 17:81473062-81473084 CTGCTGCCTCCTCGGTCAACAGG - Intergenic
1152814053 17:82397303-82397325 CTGCTGCCTCACCCGTCCCCAGG - Intronic
1152814081 17:82397381-82397403 CCGCTGCCTCACCCGTCCCCAGG - Intronic
1153229882 18:2925383-2925405 CTGCTGCCTCTTCCGTAACTGGG - Intronic
1155910605 18:31500313-31500335 CTGCTGCCTCTCCTGTGACCAGG + Intronic
1157240729 18:46007376-46007398 CTGCTGCCTTCGCCATTAGCAGG - Intronic
1160685804 19:436135-436157 GAGCTGCCTCCCCCGTGCCCTGG - Intronic
1161443499 19:4305230-4305252 CTGCCCCCTCCCCGCTTACCTGG + Intronic
1164633819 19:29778518-29778540 CTCCTGCCTCACCCGGGACCAGG - Intergenic
1165101971 19:33444432-33444454 CCGCTGCCTGGCCCCTTACCGGG - Intronic
1166628108 19:44379421-44379443 CTTCTGCCTCCCCAGTAACTGGG + Intronic
1166793781 19:45414034-45414056 CTCCTGCCTCCACCCTTTCCAGG - Exonic
925259975 2:2520618-2520640 CTGCTGCCTCTCCCCTTGTCTGG - Intergenic
926144744 2:10390020-10390042 CTGCTGCCACTCCCACTACCAGG - Intronic
928091674 2:28378368-28378390 CCGCAGCCTCCTCCTTTACCTGG + Intergenic
928234632 2:29529037-29529059 CTGCTGCCTTCCTGGTTGCCTGG - Intronic
930731185 2:54729534-54729556 CAGCTGCCTCCCCTGTAGCCTGG - Intronic
932430855 2:71672822-71672844 CTGGTGCCTCCCCCCTTTTCCGG - Intronic
932474242 2:71991533-71991555 CTGCTGCCTTCCTCTTTTCCTGG + Intergenic
934991877 2:98927277-98927299 CTGCTGCCTCCAGCGTGGCCAGG - Intronic
935800254 2:106688767-106688789 CTGCTGCTTCCCCAGTAACTAGG - Intergenic
937376332 2:121338347-121338369 CTGCTGCCTCCCCTGCAGCCAGG - Exonic
946148555 2:217748928-217748950 CTGCTGCCTCCTCCTCTTCCTGG + Intronic
946860682 2:223997758-223997780 CATCTGCCTCTCCCTTTACCTGG - Intronic
948045481 2:234940524-234940546 CTGCTCCCTCCCCAGGTAACGGG - Intergenic
1168846460 20:947916-947938 CTGAGGCCTCCCCAGTTACAAGG - Intergenic
1168858844 20:1030267-1030289 CTCCTTCCTCCCCCTTTCCCAGG + Intergenic
1169167235 20:3434608-3434630 CTCCTGCCTCCCCAGGTAGCTGG + Intergenic
1172573351 20:35987255-35987277 CTGCTACCTGCCCAATTACCTGG - Intronic
1174526210 20:51173734-51173756 CTGCAGGCTCCCCACTTACCTGG + Intergenic
1175190923 20:57211658-57211680 CTCCTGCCTCCCCTGTTATCAGG - Intronic
1175407172 20:58742779-58742801 CTGCTGCCTCCTCCCTGTCCAGG - Intergenic
1175867900 20:62191162-62191184 CTGCTGCCTCCCACGTGTCAGGG + Intronic
1176359567 21:5983312-5983334 CTGCAGCCTGCCCCGCCACCAGG - Intergenic
1179763951 21:43555238-43555260 CTGCAGCCTGCCCCGCCACCAGG + Intronic
1179880143 21:44290127-44290149 CTGCTGCCTCTGCCTTTACCTGG + Intronic
1180224075 21:46379209-46379231 CCGCTGCCTCCCCTGTCATCCGG + Intronic
1183748125 22:39704026-39704048 CAGCTGCCTCCCCTGTCAGCAGG - Intergenic
1184462278 22:44645976-44645998 CTGCTCCCTCCCCCAATGCCAGG + Intergenic
1184556915 22:45238408-45238430 GTGCTGTCTCCCCAGTTAGCAGG - Intronic
1184702598 22:46186491-46186513 CTCCTTCCTCCCTCGTTACTGGG - Intronic
1184857870 22:47156389-47156411 CTGCCGCCTCCCCCATCAGCAGG - Intronic
1184863171 22:47188418-47188440 CTGCTGGCTGCCGCGTGACCTGG + Intergenic
1185140461 22:49098022-49098044 CTGCTGTCTCTCCCGTAGCCAGG + Intergenic
949501943 3:4688400-4688422 CTTCTGACTCCCACGTTAGCAGG + Intronic
950053100 3:10006910-10006932 CTGCAGGCTCCCACGTTGCCGGG - Intronic
951910825 3:27748707-27748729 CTGCTGCCTGCCTCCTTGCCTGG - Intergenic
952885172 3:38007611-38007633 CTGCTGCCTCCCTGGGGACCAGG - Exonic
961665435 3:128491090-128491112 CTGCTACCTCCCCAGCTCCCAGG - Intronic
963898020 3:150706578-150706600 CTGCGGCCTCCCCAGTTATATGG - Intergenic
964406361 3:156352827-156352849 CTGCTGCCTGCCCTGTTTCCTGG + Intronic
968286887 3:197514067-197514089 CTGCTTCCTCCTCCCCTACCCGG + Intronic
969869059 4:10093534-10093556 CAACTGCCTCTCCCGTCACCCGG + Intronic
975706505 4:77117369-77117391 CTGAGGCCTCCCCAGCTACCTGG - Intergenic
980897132 4:138870567-138870589 CTACAGCCTTCCCTGTTACCTGG - Intergenic
981735235 4:147942734-147942756 CAGCTGCCTGCTCCTTTACCTGG - Intronic
990148447 5:52788551-52788573 CTCCTGCCTGCCCCGTAGCCTGG - Intronic
990867839 5:60399635-60399657 CTGCTGCCACCACAGTTGCCAGG - Intronic
993026730 5:82655377-82655399 CTCCTGCTTCCCCCTTCACCAGG + Intergenic
994710434 5:103258859-103258881 CCGCTGCCTCCGCCGTGCCCGGG - Exonic
996222690 5:120952849-120952871 CTGATGCCTCCCCAGTTATGTGG + Intergenic
997698710 5:135881295-135881317 CTGCTGCCTCCCCCGTGAGCTGG + Intronic
999149018 5:149414609-149414631 CTGCTGCCTCCTGCCTTCCCAGG + Intergenic
1000264281 5:159619802-159619824 CTGCTGCCTCCCTCCTTCACAGG - Intergenic
1001932909 5:175685930-175685952 CAGCTGCCACCCCCATTCCCAGG + Exonic
1002584039 5:180230216-180230238 CTGTTGTCTCCCCCGTCAGCGGG - Intergenic
1002787299 6:412320-412342 CTGCTGCCTTCGCTGTTCCCAGG + Intergenic
1003814464 6:9822465-9822487 CTGCTTCCTCACCTGTTTCCTGG - Intronic
1006142758 6:31940606-31940628 CTGCCCCCTCCCCCATCACCTGG + Intronic
1006603908 6:35243163-35243185 CTGCTCGCTCCCCGGCTACCAGG - Exonic
1007306714 6:40912454-40912476 CTGCGGCCTCCCCTGCAACCAGG + Intergenic
1007313263 6:40963621-40963643 CTGCTGCCTCCCTTGCCACCAGG + Intergenic
1007711675 6:43828175-43828197 CTGCTCCCACCCCCGTTCCCAGG + Intergenic
1007892537 6:45308590-45308612 CTCCTCCCTCCCCCGATCCCAGG - Intronic
1011259587 6:85457084-85457106 CTGCTGACTCTCCCATTGCCTGG - Intronic
1018164666 6:161081951-161081973 CTGCTGCCTACCCTGTCTCCTGG + Intronic
1019140223 6:169938110-169938132 CCGCCGCCTCCTCCGTTAACAGG + Intergenic
1019212520 6:170418090-170418112 CTGCTGCCTCTCCCTATAGCAGG - Intergenic
1022103789 7:27184523-27184545 CTGCTGCCGCCGCCGTCTCCCGG + Exonic
1022673503 7:32477506-32477528 CTGCTGCCTCCTCTGTTCTCTGG - Intergenic
1025629664 7:63259380-63259402 CTGCTGCCTCCTGGTTTACCTGG - Intergenic
1026297488 7:69067557-69067579 CTGCTGCCACCACATTTACCTGG + Intergenic
1032197275 7:129796598-129796620 CTGCTGCCTGCCCCTCTCCCAGG - Intergenic
1038049647 8:23796665-23796687 CTCCTGCCTCCCAAGTAACCCGG - Intergenic
1038188646 8:25298680-25298702 CTGCAGCCTCCTCTGTTCCCAGG + Intronic
1038509417 8:28116923-28116945 CTGCTGCCATCCCCGTCGCCTGG - Intronic
1038684833 8:29707015-29707037 GTGCTGCCTCCCCTTTTACCTGG - Intergenic
1041391588 8:57351725-57351747 GTGCTGCCTCCCTCTGTACCTGG + Intergenic
1047371905 8:124262955-124262977 CTGCTGGCTGCCCCCTGACCAGG + Intergenic
1049600801 8:143506712-143506734 CTGCTGCCTCCCGTATCACCAGG - Intronic
1049686711 8:143942080-143942102 CTCCTCCCTCCCCCGTGTCCTGG + Intronic
1050314878 9:4391144-4391166 CTGCTGCCTCTGGCTTTACCTGG + Intergenic
1052888783 9:33676794-33676816 CTGCTGCCGCAGCCATTACCCGG - Intergenic
1055770370 9:79710517-79710539 GTGCTGCCTCCCCAGTCTCCAGG + Intronic
1055795904 9:79974885-79974907 CTGCTGTCTTCCCCGGTTCCAGG + Intergenic
1056445730 9:86664915-86664937 CTGCTGCCTCTCCCCTGTCCAGG - Intergenic
1056968070 9:91180591-91180613 CTGCTGCCACCCCCCTTGGCCGG + Intergenic
1058505553 9:105662522-105662544 CTGCTGCCTCCACCGCTCCCTGG - Exonic
1061657403 9:132103276-132103298 CTGTTGCATCCCCTGTTTCCTGG - Intergenic
1061991523 9:134161841-134161863 CGGCTGCCTCCCCCACTGCCAGG - Intergenic
1062102200 9:134734150-134734172 CTGCTGCCTTCCCGGGTGCCTGG - Intronic
1062148230 9:135002615-135002637 CAGCTGCCTCCCCTCTTCCCTGG + Intergenic
1062311235 9:135938618-135938640 CTGCCGCTTCCCCACTTACCTGG + Intronic
1190771930 X:53522015-53522037 CTGCCCCCTCCCCCCTAACCAGG - Intergenic
1192091226 X:68158652-68158674 CTGCTCCCTCCCCCTTCCCCTGG + Intronic
1198090191 X:133321217-133321239 CTGCTTACTTCCCCGTAACCTGG + Intronic