ID: 1073336523

View in Genome Browser
Species Human (GRCh38)
Location 10:102714310-102714332
Sequence TGCTGCCTCCCCCGTTACCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073336511_1073336523 8 Left 1073336511 10:102714279-102714301 CCCGCCGAGTCCCTCCTCCTCCT 0: 1
1: 0
2: 3
3: 86
4: 636
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336509_1073336523 15 Left 1073336509 10:102714272-102714294 CCATCCTCCCGCCGAGTCCCTCC 0: 1
1: 0
2: 4
3: 35
4: 489
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336516_1073336523 -6 Left 1073336516 10:102714293-102714315 CCTCCTCCTCCTCCTCCTGCTGC 0: 9
1: 108
2: 3211
3: 8811
4: 17727
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336510_1073336523 11 Left 1073336510 10:102714276-102714298 CCTCCCGCCGAGTCCCTCCTCCT 0: 1
1: 1
2: 3
3: 65
4: 736
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336517_1073336523 -9 Left 1073336517 10:102714296-102714318 CCTCCTCCTCCTCCTGCTGCCTC 0: 1
1: 4
2: 229
3: 2512
4: 10356
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336514_1073336523 -2 Left 1073336514 10:102714289-102714311 CCCTCCTCCTCCTCCTCCTCCTG 0: 7
1: 321
2: 1261
3: 3333
4: 8664
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336505_1073336523 27 Left 1073336505 10:102714260-102714282 CCCCCACACTCACCATCCTCCCG 0: 1
1: 0
2: 4
3: 80
4: 484
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336515_1073336523 -3 Left 1073336515 10:102714290-102714312 CCTCCTCCTCCTCCTCCTCCTGC 0: 37
1: 2424
2: 6754
3: 13394
4: 22576
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336506_1073336523 26 Left 1073336506 10:102714261-102714283 CCCCACACTCACCATCCTCCCGC 0: 1
1: 1
2: 1
3: 50
4: 543
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336512_1073336523 7 Left 1073336512 10:102714280-102714302 CCGCCGAGTCCCTCCTCCTCCTC 0: 1
1: 0
2: 16
3: 207
4: 1408
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336508_1073336523 24 Left 1073336508 10:102714263-102714285 CCACACTCACCATCCTCCCGCCG 0: 1
1: 0
2: 0
3: 30
4: 270
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336513_1073336523 4 Left 1073336513 10:102714283-102714305 CCGAGTCCCTCCTCCTCCTCCTC 0: 1
1: 7
2: 138
3: 860
4: 4094
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1073336507_1073336523 25 Left 1073336507 10:102714262-102714284 CCCACACTCACCATCCTCCCGCC 0: 1
1: 0
2: 0
3: 44
4: 478
Right 1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073336523 Original CRISPR TGCTGCCTCCCCCGTTACCA GGG Exonic
900388169 1:2420018-2420040 TGCTGCCTCCCCAGTAGCCTGGG + Intergenic
901172108 1:7266702-7266724 TCCTGCCTCCTCCGTCACCAAGG - Intronic
919074480 1:192797241-192797263 TGGTGCATCTGCCGTTACCATGG + Intergenic
921278907 1:213546046-213546068 TGCTGCCTCCCCCGCTCACCTGG + Intergenic
1070983065 10:80665813-80665835 TGCTGCCACCCCCTTAACTAAGG - Intergenic
1072656467 10:97333918-97333940 TGCGGCCTCCCCCGGGCCCAGGG + Exonic
1073336523 10:102714310-102714332 TGCTGCCTCCCCCGTTACCAGGG + Exonic
1075559970 10:123461018-123461040 TGCTGCCTCCTCCATTCCCCTGG + Intergenic
1077061544 11:619880-619902 TGCTGCCTCCCCCGCCTCCAGGG - Exonic
1077233630 11:1469595-1469617 TGCTGCCTCCTCCATGCCCAAGG - Intronic
1080550110 11:33367042-33367064 TACTTCCTCACCTGTTACCACGG - Intergenic
1085120593 11:73965088-73965110 AGCTGCCTCCTCCCTTACCTGGG + Intronic
1089202212 11:116731386-116731408 TGCTGCCTCGCGTGTTGCCATGG + Intergenic
1090131528 11:124147151-124147173 TGATGCCTCCACTGTTCCCATGG + Exonic
1098709571 12:73738564-73738586 TGCTGCCTCCTCAGTTTCAAAGG + Intergenic
1102074424 12:110048472-110048494 TGCTGCGTCCAGCGTTACCGTGG - Intronic
1102919692 12:116782632-116782654 TCCTCCCTCCCAGGTTACCATGG + Intronic
1118743342 14:68756926-68756948 TGCGGCCTTCCCCTTTACCTGGG + Intergenic
1118787036 14:69054616-69054638 ATCTGCCTCCCCGGTCACCAAGG + Exonic
1122901482 14:104784021-104784043 TGCTGCTTCCCCCTTGCCCAGGG - Intronic
1126137633 15:45407271-45407293 TGCTACCTCTCCCTGTACCAGGG + Intronic
1126666003 15:51077119-51077141 TGCTCCCTCCCCTGTTTCCCTGG + Intronic
1127392000 15:58513257-58513279 TGCAGCCTGCCCCATTAACAAGG + Intronic
1128874175 15:71188606-71188628 TGCTGCCTGCCCCTCTCCCATGG + Intronic
1129161707 15:73751518-73751540 TGCTGCCTTCCCCCATCCCAAGG - Exonic
1130350264 15:83085175-83085197 TGCTGCCTCCCCACTTCCCAGGG - Intergenic
1135091605 16:19522184-19522206 TGGGCCCTCCCCCGTTGCCATGG - Intergenic
1138476192 16:57271907-57271929 TGCTTCCTCCCTCCTTCCCAGGG + Intronic
1141374371 16:83516731-83516753 AGCTGCCTCCCCTGTCATCATGG + Intronic
1142397591 16:89841306-89841328 TTCTGCCTCCCACCTTAGCATGG + Intronic
1148533739 17:48420569-48420591 TTCTGCCACCCCAGTTATCAGGG - Intronic
1149112981 17:53056383-53056405 TGCTGCCTCACCTTCTACCATGG + Intergenic
1149585370 17:57782787-57782809 CTGTGCCTCCCCCGCTACCAGGG + Intergenic
1150225157 17:63520705-63520727 TGCTGCCTGGCCCGTTGCCCTGG + Intronic
1151823774 17:76512379-76512401 TGCTGGCTCCACGGTCACCAAGG + Intergenic
1152814052 17:82397302-82397324 TGCTGCCTCACCCGTCCCCAGGG - Intronic
1152814080 17:82397380-82397402 CGCTGCCTCACCCGTCCCCAGGG - Intronic
1152901191 17:82941961-82941983 TGCTGTCTCTCTAGTTACCAGGG + Intronic
1154077618 18:11219444-11219466 TGATGCCTCCACGGTTTCCAAGG - Intergenic
1160685803 19:436134-436156 AGCTGCCTCCCCCGTGCCCTGGG - Intronic
1160751419 19:736199-736221 AGCTGCCACCCCCATAACCACGG - Intronic
1160842042 19:1150562-1150584 TGGTGTCTCCCCCATGACCACGG - Intronic
1160948763 19:1655703-1655725 TGCTGCCTGTCCCCGTACCAGGG - Intergenic
1161250687 19:3278619-3278641 TGCTTCCTCCCCCGTGGCCCAGG - Intronic
1164780321 19:30886421-30886443 AGCTGCCTCCCCAGCTGCCAAGG + Intergenic
1165016935 19:32888085-32888107 TGCAGCCTCTCCCGTTCCCCTGG - Intronic
1165076313 19:33281659-33281681 TGCTGCCTCCCCAGTAGCCCAGG - Intergenic
926144743 2:10390019-10390041 TGCTGCCACTCCCACTACCAGGG - Intronic
927506007 2:23615354-23615376 TGCTGCCTCCCCAGCCACCCTGG + Intronic
927636445 2:24820354-24820376 TGCTGCCACCCAGGTGACCATGG - Exonic
934991876 2:98927276-98927298 TGCTGCCTCCAGCGTGGCCAGGG - Intronic
935800253 2:106688766-106688788 TGCTGCTTCCCCAGTAACTAGGG - Intergenic
937376331 2:121338346-121338368 TGCTGCCTCCCCTGCAGCCAGGG - Exonic
943839599 2:192561918-192561940 TGCTGCCTCTCACCCTACCATGG - Intergenic
1172115563 20:32571659-32571681 TGCTTCCTCCCCAGCCACCAAGG + Intronic
1174040740 20:47697658-47697680 TCCTGGCCCCCCAGTTACCAGGG - Intronic
1175407171 20:58742778-58742800 TGCTGCCTCCTCCCTGTCCAGGG - Intergenic
1176359566 21:5983311-5983333 TGCAGCCTGCCCCGCCACCAGGG - Intergenic
1177835139 21:26179441-26179463 TGCAGCCTCCCCCGCTGCCCCGG + Intergenic
1179763952 21:43555239-43555261 TGCAGCCTGCCCCGCCACCAGGG + Intronic
1179880144 21:44290128-44290150 TGCTGCCTCTGCCTTTACCTGGG + Intronic
1181181350 22:21070653-21070675 TGCTGCCTTCCAGGTTACCATGG - Intergenic
1181593412 22:23897953-23897975 TGCTGTCTCCTCCCTTCCCATGG - Intronic
1182066459 22:27434802-27434824 TGCAGTCTCCCCGGATACCAGGG + Intergenic
1183748124 22:39704025-39704047 AGCTGCCTCCCCTGTCAGCAGGG - Intergenic
1184462279 22:44645977-44645999 TGCTCCCTCCCCCAATGCCAGGG + Intergenic
1184857869 22:47156388-47156410 TGCCGCCTCCCCCATCAGCAGGG - Intronic
954148982 3:48647857-48647879 TGCTGCCTTCCCAGTCCCCACGG - Exonic
954315386 3:49798640-49798662 TGCTCACTCCCCAGTGACCATGG - Intronic
954847041 3:53568523-53568545 TGCTGCCTCCCCTGTTAGCATGG + Intronic
955982261 3:64539171-64539193 TGGTGCCTTCCCCCTTGCCAGGG - Intronic
961328640 3:126126283-126126305 TGCGGCCTCCCCAGTGCCCACGG - Intronic
961863797 3:129938853-129938875 TGCTGCCTGCCCTGTTCCCAAGG + Intergenic
968921809 4:3526088-3526110 TGCAGCCTCCCCAGTTAGCCAGG - Intronic
969298006 4:6280945-6280967 TGCTGCCACCGCCTTGACCAGGG + Intronic
969601582 4:8179620-8179642 TGCAGCCTTCCCCATTTCCAAGG - Intergenic
973819188 4:54647803-54647825 TGCTGCCTCCCTCTGCACCACGG - Intergenic
975530717 4:75396610-75396632 TTCTGCCACCCCCGTTTCCCTGG + Intergenic
984676981 4:182560676-182560698 TGCTGCTTCTCCAGTTCCCATGG + Intronic
990145033 5:52750307-52750329 ACCTGCCTCCTCCGTCACCACGG - Intergenic
993026731 5:82655378-82655400 TCCTGCTTCCCCCTTCACCAGGG + Intergenic
996926618 5:128834393-128834415 TGCTGCCTGCCCACTTAACATGG + Intronic
996946324 5:129073734-129073756 TGCTGCTTCCCACCTTATCATGG + Intergenic
998227170 5:140336007-140336029 AGCTGCCACCCGGGTTACCATGG - Exonic
999149019 5:149414610-149414632 TGCTGCCTCCTGCCTTCCCAGGG + Intergenic
1000264280 5:159619801-159619823 TGCTGCCTCCCTCCTTCACAGGG - Intergenic
1001771750 5:174302154-174302176 TGCTGACTCCCACTTTACAAAGG + Intergenic
1001932910 5:175685931-175685953 AGCTGCCACCCCCATTCCCAGGG + Exonic
1002067188 5:176657786-176657808 CACTGCCTCCCCAGTCACCAAGG + Exonic
1003881197 6:10481427-10481449 TGCTGCCTCCTCCTTTCCCAAGG + Intergenic
1003921678 6:10838549-10838571 TGCTGCCCCCGCCGTTTCCTAGG - Intronic
1006398242 6:33801012-33801034 TGCTGCCTGCCCTGCTAGCAAGG - Intronic
1006640827 6:35488850-35488872 TGCAGCCTCCCCCCTCAGCATGG + Intronic
1007313264 6:40963622-40963644 TGCTGCCTCCCTTGCCACCAGGG + Intergenic
1010305713 6:74319419-74319441 TGCTTCCTCCCCCCCTACCAAGG - Intergenic
1012001267 6:93658184-93658206 TCCTGCCTTCCCAGTCACCATGG - Intergenic
1012517721 6:100081916-100081938 TGCTGCCTCCCTCATAACAACGG + Intergenic
1014460551 6:121689869-121689891 TGCTGCCAATCCTGTTACCATGG + Intergenic
1015153513 6:130064648-130064670 TGCTGCCTCCCACCACACCATGG - Intronic
1017781943 6:157722055-157722077 TGCTGGGTCCCCGGTTTCCAAGG + Intronic
1018334282 6:162769060-162769082 AGCTGCCTCCACATTTACCATGG - Intronic
1019212519 6:170418089-170418111 TGCTGCCTCTCCCTATAGCAGGG - Intergenic
1022455703 7:30556563-30556585 TGCTGCCTCTGCTGTCACCAAGG - Intergenic
1026167293 7:67921810-67921832 TCCTGCCTCCCCTGTTCCCCAGG - Intergenic
1027776585 7:82472916-82472938 TGCTGCCTTTCCTATTACCAGGG - Intergenic
1033356152 7:140601849-140601871 GGCTGGATCCCCAGTTACCAGGG - Exonic
1034303662 7:150035448-150035470 GGGTGCCTCCCCCGTTGCGATGG + Intergenic
1037735871 8:21565474-21565496 TGCTGCCTGCCCCTCTACCGTGG - Intergenic
1041858783 8:62487165-62487187 TGCTGGCTCCCCGTTTACCCAGG + Intronic
1044445247 8:92267547-92267569 TGCTGCATGCTCTGTTACCAAGG - Intergenic
1048015349 8:130491739-130491761 TGCTGTGTCCCCCGTCTCCATGG + Intergenic
1048890756 8:138944340-138944362 AGCTTCCTCCCCTGTAACCATGG + Intergenic
1048936674 8:139363344-139363366 TGCTGCCTCCCAGGTTGCCATGG + Intergenic
1049442266 8:142614816-142614838 TGCTGCCTCCCAGGGTCCCAAGG + Intergenic
1050705457 9:8391767-8391789 TGCCACCTCCCCCCTTATCAAGG + Intronic
1055770371 9:79710518-79710540 TGCTGCCTCCCCAGTCTCCAGGG + Intronic
1058924855 9:109653134-109653156 TGCTGCCTCACCCATGATCACGG - Intronic
1059062957 9:111052763-111052785 TGCAGCCTCCCTCTTTGCCATGG - Intergenic
1060876037 9:127084297-127084319 TTCTTCCTCCCCTGTTGCCACGG - Intronic
1185666180 X:1767206-1767228 GGCTGGCTTCCCCGTTTCCATGG - Intergenic
1188413025 X:29897204-29897226 TGCTGCCATCCCTGTTAACAAGG + Intronic
1190347372 X:49530755-49530777 TGCAGACTCACCCGTTACAATGG + Intergenic
1192166788 X:68831560-68831582 TCCAGCCTCCACCCTTACCAGGG - Intronic
1202269082 Y:23053241-23053263 TGCAGCTTCCCCTGATACCACGG - Intergenic
1202422074 Y:24686981-24687003 TGCAGCTTCCCCTGATACCACGG - Intergenic
1202448712 Y:24983097-24983119 TGCAGCTTCCCCTGATACCACGG + Intergenic